View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-36 (Length: 552)

Name: J5-5-36
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-36
J5-5-36
[»] chr2 (3 HSPs)
chr2 (1-183)||(42933467-42933649)
chr2 (178-327)||(42933056-42933205)
chr2 (379-543)||(42933257-42933422)


Alignment Details
Target: chr2 (Bit Score: 183; Significance: 1e-98; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 183; E-Value: 1e-98
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 42933467 - 42933649
Alignment:
1 gatcctgttggtggttgttatagattcattcaacagcttcaatctcaatatgaattttatcaagctgagcttcatcttacacgtcaacaaatttctattt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42933467 gatcctgttggtggttgttatagattcattcaacagcttcaatctcaatatgaattttatcaagctgagcttcatcttacacgtcaacaaatttctattt 42933566  T
101 gtaaagctacacaatcacaacaacatcaacaacaatttgccgctgtgtctaatcatcattataatgacatgcatgtcattaat 183  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42933567 gtaaagctacacaatcacaacaacatcaacaacaatttgccgctgtgtctaatcatcattataatgacatgcatgtcattaat 42933649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 150; E-Value: 5e-79
Query Start/End: Original strand, 178 - 327
Target Start/End: Original strand, 42933056 - 42933205
Alignment:
178 attaatttcttaaaattacaacgtgaaatataatattggagtaaataatagaagagccagaaaaagcagcagaaaatttgcagggtgcataggcagcgga 277  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42933056 attaatttcttaaaattacaacgtgaaatataatattggagtaaataatagaagagccagaaaaagcagcagaaaatttgcagggtgcataggcagcgga 42933155  T
278 gacgcttagcttattataaaatttagggtttggtttttccatgaagcatg 327  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
42933156 gacgcttagcttattataaaatttagggtttggtttttccatgaagcatg 42933205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 129; E-Value: 2e-66
Query Start/End: Original strand, 379 - 543
Target Start/End: Original strand, 42933257 - 42933422
Alignment:
379 gcttgtgctgcatgtaaatatcaacgtaggaagtgtggtacatcctgcattctcgcaccatattttcctcacgatcgtcnaaaacaattcttaaacgctc 478  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
42933257 gcttgtgctgcatgtaaatatcaacgtaggaagtgtggtacatcctgcattctcgcaccatattttcctcacgatcgtcaaaaacaattcttaaacgctc 42933356  T
479 ataaattggtttggtgctgggaaaatcaccaatatgatcaag-atgttcc-cctcatcttanagatc 543  Q
    ||||||| |||||||| ||| ||||||||||||||||||||| ||||||| |||||||||| |||||    
42933357 ataaatt-gtttggtgttggtaaaatcaccaatatgatcaagaatgttccacctcatcttagagatc 42933422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 202287 times since January 2019
Visitors: 1515