View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-37 (Length: 399)

Name: J5-5-37
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-37
J5-5-37
[»] chr2 (10 HSPs)
chr2 (122-397)||(1435755-1436030)
chr2 (122-342)||(21019576-21019802)
chr2 (136-376)||(1448592-1448832)
chr2 (1-127)||(1436216-1436342)
chr2 (201-376)||(1441253-1441428)
chr2 (136-376)||(1455348-1455588)
chr2 (130-376)||(1429153-1429399)
chr2 (2-124)||(1429610-1429734)
chr2 (59-127)||(1455859-1455927)
chr2 (2-58)||(21018023-21018079)
[»] chr1 (1 HSPs)
chr1 (295-360)||(43826570-43826635)


Alignment Details
Target: chr2 (Bit Score: 260; Significance: 1e-145; HSPs: 10)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 122 - 397
Target Start/End: Original strand, 1435755 - 1436030
Alignment:
122 attaatgctcttaatgttgaatttcaaaagttccagtttcaaactaaaaccgcgtctatgtatattgattctgttgttgtagaacgtaatggctctcaac 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1435755 attaatgctcttaatgttgaatttcaaaagttccagtttcaaactaaaaccgcgtctatgtatattgattctgttgttgtagaacgtaatggctctcaac 1435854  T
222 ctccgcttgagtggccaatgcggaaaaatattgcgttgggatctgccagggggattgcttacttgcattatagttgtgaccctaagattattcaccgtga 321  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1435855 ctccgcttgagtggccaatgcggaaaaatattgcgttgggatctgccagggggattgcttacttgcattatagttgtgaccctaagattattcaccgtga 1435954  T
322 tgtgaaagctgcaaatatattgttggatgaggaatttgaagcanttgttggagatnttggttangccntgcttatg 397  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||  ||||||||    
1435955 tgtgaaagctgcaaatatattgttggatgaggaatttgaagcaattgttggagattttggttatgcaatgcttatg 1436030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 122 - 342
Target Start/End: Complemental strand, 21019802 - 21019576
Alignment:
122 attaatgctcttaatgttgaatttcaaaagttccagtttcaaactaa---aaccgcgtctatgtatattgattctgttgttgtagaacgtaatggctctc 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||   ||||||| |||||||||||||||||||||||||||||||||||| |||||    
21019802 attaatgctcttaatgttgaatttcaaaagttccagtttcaaactaataaaaccgcgactatgtatattgattctgttgttgtagaacgtaatgactctc 21019703  T
219 aacctccgcttgagtggccaatgcggaaaaatattgcgttgggatctgccagggggattgcttacttgcattatagttgtgac---cctaagattattca 315  Q
    ||||||||||||| ||| |||||||||| ||||||||  ||||||||||||||||||||||||||||||||||||||| ||||   ||||||||||||||    
21019702 aacctccgcttgactggacaatgcggaagaatattgcagtgggatctgccagggggattgcttacttgcattatagttatgaccctcctaagattattca 21019603  T
316 ccgtgatgtgaaagctgcaaatatatt 342  Q
    ||||||||||||||||||||| |||||    
21019602 ccgtgatgtgaaagctgcaaacatatt 21019576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 136 - 376
Target Start/End: Original strand, 1448592 - 1448832
Alignment:
136 tgttgaatttcaaaagttccagtttcaaactaaaaccgcgtctatgtatattgattctgttgttgtagaacgtaatggctctcaacctccgcttgagtgg 235  Q
    |||| |||| ||||| || |||||||| | || ||| || |||||||||||||||| |||| ||||||||||||||| ||||||||| |||||||| |||    
1448592 tgttaaattccaaaatttgcagtttcatattataactgcatctatgtatattgattgtgtttttgtagaacgtaatgactctcaaccgccgcttgactgg 1448691  T
236 ccaatgcggaaaaatattgcgttgggatctgccagggggattgcttacttgcattatagttgtgaccctaagattattcaccgtgatgtgaaagctgcaa 335  Q
    ||||||||||| ||||||||| | ||| ||||||||||| |||||||||||||| ||  ||||||||||||||||||||| |||||||||||||||||||    
1448692 ccaatgcggaagaatattgcgctaggagctgccagggggcttgcttacttgcatgatcattgtgaccctaagattattcatcgtgatgtgaaagctgcaa 1448791  T
336 atatattgttggatgaggaatttgaagcanttgttggagat 376  Q
    |||||||||||||||| ||||||| |||| |||||||||||    
1448792 atatattgttggatgatgaatttgtagcagttgttggagat 1448832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 1436216 - 1436342
Alignment:
1 attgcttgattgggtaggttttcctttaactttaaatatgtcattagtagttgaacaattttgttaaccgtgtatttacggtgatttttagttaaattct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1436216 attgcttgattgggtaggttttcctttaactttaaatatgtcattagtagttgaacaattttgttaaccgtgtatttacggtgatttttagttaaattct 1436315  T
101 gcctccaacactgtggcatgcattaat 127  Q
    |||||||||||||||||||||||||||    
1436316 gcctccaacactgtggcatgcattaat 1436342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 201 - 376
Target Start/End: Original strand, 1441253 - 1441428
Alignment:
201 tagaacgtaatggctctcaacctccgcttgagtggccaatgcggaaaaatattgcgttgggatctgccagggggattgcttacttgcattatagttgtga 300  Q
    |||||||||||| |||||| || ||||||||||||||||||||||| ||||||||| ||||| ||||||||||| |||||||||||||| ||  ||||||    
1441253 tagaacgtaatgactctcagccgccgcttgagtggccaatgcggaagaatattgcgctgggagctgccagggggcttgcttacttgcatgatcattgtga 1441352  T
301 ccctaagattattcaccgtgatgtgaaagctgcaaatatattgttggatgaggaatttgaagcanttgttggagat 376  Q
    ||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||| |||||||||||    
1441353 ccctaagattattcatcgtgatgtgaaagcagcgaatatattgttggatgaggaatttgaagcagttgttggagat 1441428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 136 - 376
Target Start/End: Original strand, 1455348 - 1455588
Alignment:
136 tgttgaatttcaaaagttccagtttcaaactaaaaccgcgtctatgtatattgattctgttgttgtagaacgtaatggctctcaacctccgcttgagtgg 235  Q
    ||||||||||||||| || |||||||| | || |||  | ||||||||||||  || |||||||||||||||||||| ||||||||| || ||||| |||    
1455348 tgttgaatttcaaaatttgcagtttcatattataactccatctatgtatattctttttgttgttgtagaacgtaatgcctctcaaccgccacttgattgg 1455447  T
236 ccaatgcggaaaaatattgcgttgggatctgccagggggattgcttacttgcattatagttgtgaccctaagattattcaccgtgatgtgaaagctgcaa 335  Q
    |||||| |||| ||||||| | ||||| |||||| |||| | |||||||||||| ||  |||||| |||||| ||||||| |||||||||||||| || |    
1455448 ccaatgaggaagaatattgggctgggagctgccaaggggctggcttacttgcatgatcattgtgatcctaaggttattcatcgtgatgtgaaagcagcga 1455547  T
336 atatattgttggatgaggaatttgaagcanttgttggagat 376  Q
    ||||||||||||||||||||||||||||| |||||||||||    
1455548 atatattgttggatgaggaatttgaagcagttgttggagat 1455588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 130 - 376
Target Start/End: Original strand, 1429153 - 1429399
Alignment:
130 tcttaatgttgaatttcaaaagttccagtttcaaactaaaaccgcgtctatgtatattgattctgttgttgtagaacgtaatggctctcaacctccgctt 229  Q
    ||||| |||||||  |||||| || |||||||| | |||||| | || |  || |||||||| || ||||||||||||||| |    | | || ||||||    
1429153 tcttactgttgaaaatcaaaatttgcagtttcatattaaaactgtgttttggtgtattgattttgatgttgtagaacgtaacgaggttgatccgccgctt 1429252  T
230 gagtggccaatgcggaaaaatattgcgttgggatctgccagggggattgcttacttgcattatagttgtgaccctaagattattcaccgtgatgtgaaag 329  Q
    ||||||||||||||||| ||||||||  ||||||||||||| ||| |||||||||||||| ||   |||||||||||||||||||| |||||||||||||    
1429253 gagtggccaatgcggaagaatattgcactgggatctgccagagggcttgcttacttgcatgatcactgtgaccctaagattattcatcgtgatgtgaaag 1429352  T
330 ctgcaaatatattgttggatgaggaatttgaagcanttgttggagat 376  Q
    ||||||||||||||||||||||||||||||||||| |||| ||||||    
1429353 ctgcaaatatattgttggatgaggaatttgaagcagttgtgggagat 1429399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 2 - 124
Target Start/End: Original strand, 1429610 - 1429734
Alignment:
2 ttgcttgattgggtaggttttcctttaactttaaat-atgtcattagtagttgaacaatttt-gttaaccgtgtatttacggtgatttttagttaaattc 99  Q
    ||||||||||||||||||||||  ||| ||| |||  |||||||||||| |||||||||||| |||||| || | ||||| ||||||||| ||||| |||    
1429610 ttgcttgattgggtaggttttcaattatcttaaaaacatgtcattagtatttgaacaatttttgttaactgtctgtttacagtgatttttggttaagttc 1429709  T
100 tgcctccaacactgtggcatgcatt 124  Q
    ||| ||||||||  |||||||||||    
1429710 tgcatccaacaccatggcatgcatt 1429734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 59 - 127
Target Start/End: Original strand, 1455859 - 1455927
Alignment:
59 ttttgttaaccgtgtatttacggtgatttttagttaaattctgcctccaacactgtggcatgcattaat 127  Q
    ||||||||||||||||||||| || |||||| ||| |||||||| |||||||| |||||||||||||||    
1455859 ttttgttaaccgtgtatttaccgtcatttttggttgaattctgcttccaacaccgtggcatgcattaat 1455927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 21018079 - 21018023
Alignment:
2 ttgcttgattgggtaggttttcctttaactttaaatatgtcattagtagttgaacaa 58  Q
    |||||||||| ||||||||||||||||||| |||||||||  ||||| |||||||||    
21018079 ttgcttgatttggtaggttttcctttaactataaatatgtttttagttgttgaacaa 21018023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 360
Target Start/End: Complemental strand, 43826635 - 43826570
Alignment:
295 ttgtgaccctaagattattcaccgtgatgtgaaagctgcaaatatattgttggatgaggaatttga 360  Q
    ||||||||| || || ||||| ||||| ||||||||||| || |||||||||||||| || |||||    
43826635 ttgtgacccaaaaatcattcatcgtgacgtgaaagctgctaacatattgttggatgaagagtttga 43826570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361291 times since January 2019
Visitors: 487