View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-6 (Length: 591)

Name: J5-5-6
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-6
J5-5-6
[»] chr4 (3 HSPs)
chr4 (165-548)||(24507159-24507543)
chr4 (1-133)||(24507575-24507707)
chr4 (542-574)||(24508022-24508054)


Alignment Details
Target: chr4 (Bit Score: 345; Significance: 0; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 165 - 548
Target Start/End: Complemental strand, 24507543 - 24507159
Alignment:
165 atgcatgtgtaattaaaatcttcatccaactttttaccnnnnnnnnt-cttcatccaactcgactatcttaattttgtggataagaatctctttgaagtg 263  Q
    ||||||||||||||||||||||||||||||||||||||        | ||||||||||||||||||||||||||||||||||||||||||||||||||||    
24507543 atgcatgtgtaattaaaatcttcatccaactttttaccaaaaaaaatacttcatccaactcgactatcttaattttgtggataagaatctctttgaagtg 24507444  T
264 gtgtcaaacccaacaagtgagtacttcttttagttgatattcaaagttcctttcgtcatattgttctttcattaaactcaactcttgataatctttatga 363  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
24507443 gtgtcaaacccaacaagtgagtacttcttttagttgatattcaaagttcctttcgtcatattgttctttcattagactcaactcttgataatctttatga 24507344  T
364 tagattgtatgaaaatggttatgaaaattggagaaaagccaggtataaagaaaaagaagtactatcattaaaaatcgcagcgaagaaaagtataggacaa 463  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24507343 tagattgtatgaaaatggttatgaaaattggagaaaagccaggtataaagaaaaagaagtactatcattaaaaatcgcagcgaagaaaagtataggacaa 24507244  T
464 gaatgcacacactgtcgcacaatatgaaaaacaaaatcattgggttgaagtacaagagagagatccagggtaggtgacattaatc 548  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
24507243 gaatgcacacactgtcgcacaatatgaaaaacaaaatcattgggttgaagtacaagagagagatccaaggtaggtgacattaatc 24507159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 129; E-Value: 2e-66
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 24507707 - 24507575
Alignment:
1 aatagtattcattttcaagttccataatatggtgtttagtttgctagctcatgtaaacattttaatgttcattttggactccacttatgtatcattaaag 100  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24507707 aatagtattcattttcaagttccataatatggtgtttagtttactagctcatgtaaacattttaatgttcattttggactccacttatgtatcattaaag 24507608  T
101 tcggaattggtcataagtcaatccaactatttg 133  Q
    |||||||||||||||||||||||||||||||||    
24507607 tcggaattggtcataagtcaatccaactatttg 24507575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 542 - 574
Target Start/End: Complemental strand, 24508054 - 24508022
Alignment:
542 attaatcaatcccctcatctctgatcataaata 574  Q
    |||||||||||||||||||||||||||||||||    
24508054 attaatcaatcccctcatctctgatcataaata 24508022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176036 times since January 2019
Visitors: 1577