View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-72 (Length: 255)

Name: J5-5-72
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] J5-5-72
[»] chr5 (1 HSPs)
chr5 (1-144)||(3332442-3332585)

Alignment Details
Target: chr5 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 3332442 - 3332585
1 tgaatcggtgtcgccaccggaaccacctcctccggattctaacttggggctaaaatctgtgctgaacttgttgttgctgttttcttctcggtttgtgagg 100  Q
3332442 tgaatcggtgtcgccaccggaaccacctcctccggattctaacttggggctaaaatctgtgctgaacttgttgttgctgttttcttctcggtttgtgagg 3332541  T
101 ttgagtccaccgccgctgctacttccgctttgttcatcttgatc 144  Q
3332542 ttgagtccaccgccgctgctacttccgctttgttcatcttgatc 3332585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 105799 times since January 2019
Visitors: 1319