View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-73 (Length: 591)

Name: J5-5-73
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-73
J5-5-73
[»] chr1 (17 HSPs)
chr1 (1-379)||(17810316-17810694)
chr1 (376-571)||(17810939-17811134)
chr1 (148-379)||(35900325-35900556)
chr1 (148-379)||(44613887-44614118)
chr1 (149-379)||(11543097-11543327)
chr1 (427-548)||(35899798-35899919)
chr1 (264-379)||(44146311-44146426)
chr1 (394-548)||(44613388-44613542)
chr1 (425-564)||(11543721-11543860)
chr1 (421-479)||(44794846-44794904)
chr1 (148-247)||(44794352-44794451)
chr1 (511-571)||(44145769-44145829)
chr1 (189-243)||(44146259-44146313)
chr1 (1-43)||(44146077-44146119)
chr1 (321-379)||(44794276-44794334)
chr1 (503-548)||(44794796-44794841)
chr1 (1-37)||(35900184-35900220)
[»] scaffold0061 (3 HSPs)
scaffold0061 (149-373)||(27808-28032)
scaffold0061 (412-571)||(28416-28575)
scaffold0061 (1-66)||(28106-28171)
[»] scaffold0017 (6 HSPs)
scaffold0017 (149-373)||(170760-170984)
scaffold0017 (143-379)||(181841-182077)
scaffold0017 (394-548)||(181286-181440)
scaffold0017 (412-571)||(170217-170376)
scaffold0017 (1-48)||(181708-181755)
scaffold0017 (1-66)||(170621-170686)
[»] chr2 (2 HSPs)
chr2 (148-379)||(29227526-29227757)
chr2 (148-379)||(29340825-29341056)
[»] chr3 (3 HSPs)
chr3 (148-379)||(26729504-26729735)
chr3 (394-571)||(26728935-26729112)
chr3 (417-548)||(8343365-8343496)
[»] chr5 (3 HSPs)
chr5 (187-379)||(29506179-29506371)
chr5 (394-571)||(29506805-29506982)
chr5 (1-71)||(29506490-29506560)


Alignment Details
Target: chr1 (Bit Score: 379; Significance: 0; HSPs: 17)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 1 - 379
Target Start/End: Complemental strand, 17810694 - 17810316
Alignment:
1 atcaggaggaatcccaacttgtgtaatgaattttactgcaatgactcaagacaccgtgaactcaacttcatcgaagaatcatgggtatacaatcagtacg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17810694 atcaggaggaatcccaacttgtgtaatgaattttactgcaatgactcaagacaccgtgaactcaacttcatcgaagaatcatgggtatacaatcagtacg 17810595  T
101 gctacttcatttttggaaatatattatgatttcacctcgttcctgacgtggaaaggtgtagaccaaccttacaaagatgctgatgtgtttttaaaaagca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17810594 gctacttcatttttggaaatatattatgatttcacctcgttcctgacgtggaaaggtgtagaccaaccttacaaagatgctgatgtgtttttaaaaagca 17810495  T
201 ttgatctttcaagcaaccatcttacaggggacataccagctgaaattgagtacttgtttggattgatttccttaaatttgtcaaggaacaatctcagtgg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17810494 ttgatctttcaagcaaccatcttacaggggacataccagctgaaattgagtacttgtttggattgatttccttaaatttgtcaaggaacaatctcagtgg 17810395  T
301 ggaagtcatttcaaacataggaaacttcaaatcactcgaatttcttgatctgtcaagaaatcatctgtcaggcagaatt 379  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17810394 ggaagtcatttcaaacataggaaacttcaaatcactcgaatttcttgatctgtcaagaaatcatctgtcaggcagaatt 17810316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 376 - 571
Target Start/End: Complemental strand, 17811134 - 17810939
Alignment:
376 aattggatttatgtagggtgcaacaaaagtaagaccaacattttgggaattttggatttatcaaacaatgaattaaagggtgagttgcctgattgttgga 475  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17811134 aattggatttatgtagggtgcaacaaaagtaagaccaacattttgggaattttggatttatcaaacaatgaattaaagggtgagttgcctgattgttgga 17811035  T
476 ataacttagcatcattacaatttgttgacctcagaaataacaagttgtcaggaaagattcccttctcaatgggggnccttggtaacatggaggctt 571  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||    
17811034 ataacttagcatcattacaatttgttgacctcagaaataacaagttgtcaggaaagattcccttctcaatgggtgcccttgttaacatggaggctt 17810939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 148 - 379
Target Start/End: Original strand, 35900325 - 35900556
Alignment:
148 gtggaaaggtgtagaccaaccttacaaagatgctgatgtgtttttaaaaagcattgatctttcaagcaaccatcttacaggggacataccagctgaaatt 247  Q
    ||||||||| |||||||||| ||||| | || || ||  |||||||||||  |||||||||||||||||||||||||||||||| ||||||| ||||||     
35900325 gtggaaaggggtagaccaactttacataaatccttataggtttttaaaaacaattgatctttcaagcaaccatcttacaggggaaataccagttgaaatg 35900424  T
248 gagtacttgtttggattgatttccttaaatttgtcaaggaacaatctcagtggggaagtcatttcaaacataggaaacttcaaatcactcgaatttcttg 347  Q
    |||||||| ||||| |||||||||||||||||||| ||||||||||||||||||||| ||||| | ||||||||||||||||| ||||| ||||||||||    
35900425 gagtacttatttggtttgatttccttaaatttgtcgaggaacaatctcagtggggaaatcattccgaacataggaaacttcaagtcacttgaatttcttg 35900524  T
348 atctgtcaagaaatcatctgtcaggcagaatt 379  Q
    |||| |||||||||||||| ||||| ||||||    
35900525 atctctcaagaaatcatctttcaggaagaatt 35900556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 120; E-Value: 4e-61
Query Start/End: Original strand, 148 - 379
Target Start/End: Original strand, 44613887 - 44614118
Alignment:
148 gtggaaaggtgtagaccaaccttacaaagatgctgatgtgtttttaaaaagcattgatctttcaagcaaccatcttacaggggacataccagctgaaatt 247  Q
    |||||||||||| ||||||   | |||| |||| |||  ||||||||||| ||||||||| ||||||||||||||||| ||||| |||||| | ||| ||    
44613887 gtggaaaggtgtggaccaagacttcaaaaatgcagataagtttttaaaaaccattgatctctcaagcaaccatcttactggggaaataccatcggaagtt 44613986  T
248 gagtacttgtttggattgatttccttaaatttgtcaaggaacaatctcagtggggaagtcatttcaaacataggaaacttcaaatcactcgaatttcttg 347  Q
     | |||||  ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||| ||||||||||    
44613987 caatacttaattggattgatttccttaaatttgtcaaggaacaatctcagtggggaaatcatttcaaacataggaaacttcaagttacttgaatttcttg 44614086  T
348 atctgtcaagaaatcatctgtcaggcagaatt 379  Q
    ||||||||||||||  ||| ||||| ||||||    
44614087 atctgtcaagaaattgtctttcaggtagaatt 44614118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 149 - 379
Target Start/End: Complemental strand, 11543327 - 11543097
Alignment:
149 tggaaaggtgtagaccaaccttacaaagatgctgatgtgtttttaaaaagcattgatctttcaagcaaccatcttacaggggacataccagctgaaattg 248  Q
    |||||||||||||| ||||| |||| | |||| |||  | ||||||||||||||||| | ||||||||||||||||||||||| ||||||   |||||||    
11543327 tggaaaggtgtagatcaaccctacagaaatgcagataggcttttaaaaagcattgatatgtcaagcaaccatcttacaggggaaataccaatggaaattg 11543228  T
249 agtacttgtttggattgatttccttaaatttgtcaaggaacaatctcagtggggaagtcatttcaaacataggaaacttcaaatcactcgaatttcttga 348  Q
    |||| ||  ||||||||||||| |||||||||||||| ||||||||||||||| || | ||| ||||||||||||||||||| ||||| |||||||||||    
11543227 agtatttaattggattgatttcattaaatttgtcaagaaacaatctcagtgggaaaataattgcaaacataggaaacttcaagtcacttgaatttcttga 11543128  T
349 tctgtcaagaaatcatctgtcaggcagaatt 379  Q
    |||||||||||| | ||| ||||||||||||    
11543127 tctgtcaagaaaccgtctttcaggcagaatt 11543097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 427 - 548
Target Start/End: Original strand, 35899798 - 35899919
Alignment:
427 ttggatttatcaaacaatgaattaaagggtgagttgcctgattgttggaataacttagcatcattacaatttgttgacctcagaaataacaagttgtcag 526  Q
    ||||| || ||||||||||||||||||||||||||| |||||||||||||||| ||| | |||||||||| | ||||||| ||||||||||||||||| |    
35899798 ttggacttgtcaaacaatgaattaaagggtgagttgtctgattgttggaataatttatcctcattacaatatattgacctgagaaataacaagttgtctg 35899897  T
527 gaaagattcccttctcaatggg 548  Q
    ||||||||||||||||||||||    
35899898 gaaagattcccttctcaatggg 35899919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 264 - 379
Target Start/End: Original strand, 44146311 - 44146426
Alignment:
264 tgatttccttaaatttgtcaaggaacaatctcagtggggaagtcatttcaaacataggaaacttcaaatcactcgaatttcttgatctgtcaagaaatca 363  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||| | |||||||||||||| ||||||||||     
44146311 tgatttccttaaatttgtcaaggaacaatctcagtggggaaatcatttcaaacataggaaactttaactcattagaatttcttgatctttcaagaaatcg 44146410  T
364 tctgtcaggcagaatt 379  Q
    ||| ||||||| ||||    
44146411 tctttcaggcaaaatt 44146426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 394 - 548
Target Start/End: Original strand, 44613388 - 44613542
Alignment:
394 tgcaacaaaagtaagaccaacattttgggaattttggatttatcaaacaatgaattaaagggtgagttgcctgattgttggaataacttagcatcattac 493  Q
    ||||||| ||||||  | |||||||||| |||||||||||||||||||||| || ||||||||||||| |||||||||||||||||  || | || |||     
44613388 tgcaacagaagtaattctaacattttggaaattttggatttatcaaacaatcaaataaagggtgagttacctgattgttggaataatctaacctcgttaa 44613487  T
494 aatttgttgacctcagaaataacaagttgtcaggaaagattcccttctcaatggg 548  Q
    ||||||||||| | ||||||||||| || |  ||||||||||| |||||||||||    
44613488 aatttgttgacttaagaaataacaaattatggggaaagattccattctcaatggg 44613542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 425 - 564
Target Start/End: Complemental strand, 11543860 - 11543721
Alignment:
425 ttttggatttatcaaacaatgaattaaagggtgagttgcctgattgttggaataacttagcatcattacaatttgttgacctcagaaataacaagttgtc 524  Q
    |||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| ||| | ||  || | | |||||||||||| ||||||||||||||    
11543860 ttttggatatatcaaacaatcaattaaagggtgagctgcctgattgttggaataatttaacctcgctatactatgttgacctcagtaataacaagttgtc 11543761  T
525 aggaaagattcccttctcaatgggggnccttggtaacatg 564  Q
     |||||||| || || || ||||| | ||||| |||||||    
11543760 gggaaagatcccattgtcgatgggtgcccttgttaacatg 11543721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 421 - 479
Target Start/End: Complemental strand, 44794904 - 44794846
Alignment:
421 ggaattttggatttatcaaacaatgaattaaagggtgagttgcctgattgttggaataa 479  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||    
44794904 ggaattttggatatatcaaacaatgaattaaagggagagttgcctgattgttggaataa 44794846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 148 - 247
Target Start/End: Complemental strand, 44794451 - 44794352
Alignment:
148 gtggaaaggtgtagaccaaccttacaaagatgctgatgtgtttttaaaaagcattgatctttcaagcaaccatcttacaggggacataccagctgaaatt 247  Q
    |||||||||||| ||||||   | |||| |||| |||  ||||||||||| ||||||||| |||||||||||||||||||| || |||||| ||||||||    
44794451 gtggaaaggtgtggaccaagacttcaaaaatgcagataagtttttaaaaaccattgatctctcaagcaaccatcttacaggcgaaataccaactgaaatt 44794352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 511 - 571
Target Start/End: Original strand, 44145769 - 44145829
Alignment:
511 aataacaagttgtcaggaaagattcccttctcaatgggggnccttggtaacatggaggctt 571  Q
    ||||||||||||||||||||||||||  |||||||||| | ||||  ||||||||||||||    
44145769 aataacaagttgtcaggaaagattccaatctcaatgggtgccctttctaacatggaggctt 44145829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 189 - 243
Target Start/End: Original strand, 44146259 - 44146313
Alignment:
189 ttttaaaaagcattgatctttcaagcaaccatcttacaggggacataccagctga 243  Q
    ||||||||| ||||||||| ||||||||||||||||||||| | |||||| ||||    
44146259 ttttaaaaaccattgatctctcaagcaaccatcttacagggtaaataccaactga 44146313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 44146077 - 44146119
Alignment:
1 atcaggaggaatcccaacttgtgtaatgaattttactgcaatg 43  Q
    ||||||||||||||||||||||||||  ||||||||| |||||    
44146077 atcaggaggaatcccaacttgtgtaaataattttacttcaatg 44146119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 321 - 379
Target Start/End: Complemental strand, 44794334 - 44794276
Alignment:
321 gaaacttcaaatcactcgaatttcttgatctgtcaagaaatcatctgtcaggcagaatt 379  Q
    ||||||| || ||| | |||||||||||||| |||||||||||| ||||||||| ||||    
44794334 gaaactttaactcattagaatttcttgatctttcaagaaatcatttgtcaggcaaaatt 44794276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 503 - 548
Target Start/End: Complemental strand, 44794841 - 44794796
Alignment:
503 acctcagaaataacaagttgtcaggaaagattcccttctcaatggg 548  Q
    ||||||| ||||| |||||| ||||||||||||| |||||||||||    
44794841 acctcagcaataataagttgacaggaaagattccattctcaatggg 44794796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 35900184 - 35900220
Alignment:
1 atcaggaggaatcccaacttgtgtaatgaattttact 37  Q
    |||||||||||||||||||||||||| |||| |||||    
35900184 atcaggaggaatcccaacttgtgtaaagaatcttact 35900220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0061 (Bit Score: 145; Significance: 5e-76; HSPs: 3)
Name: scaffold0061
Description:

Target: scaffold0061; HSP #1
Raw Score: 145; E-Value: 5e-76
Query Start/End: Original strand, 149 - 373
Target Start/End: Complemental strand, 28032 - 27808
Alignment:
149 tggaaaggtgtagaccaaccttacaaagatgctgatgtgtttttaaaaagcattgatctttcaagcaaccatcttacaggggacataccagctgaaattg 248  Q
    ||||||||||||||||||   |||||| |||| |||  ||||||||||| ||||||||| ||||||||||||||||||||||| |||||| ||||||| |    
28032 tggaaaggtgtagaccaatggtacaaaaatgcagataagtttttaaaaaccattgatctctcaagcaaccatcttacaggggaaataccaactgaaatgg 27933  T
249 agtacttgtttggattgatttccttaaatttgtcaaggaacaatctcagtggggaagtcatttcaaacataggaaacttcaaatcactcgaatttcttga 348  Q
    ||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||| ||    
27932 agtacttatttggtttgatttcattaaatttgtcaaggaacaatctcagtggggaaatcattttaaacataggaaacttcaaatcacttgaatttctaga 27833  T
349 tctgtcaagaaatcatctgtcaggc 373  Q
    |||||||||||||||| ||||||||    
27832 tctgtcaagaaatcatttgtcaggc 27808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0061; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 412 - 571
Target Start/End: Complemental strand, 28575 - 28416
Alignment:
412 aacattttgggaattttggatttatcaaacaatgaattaaagggtgagttgcctgattgttggaataacttagcatcattacaatttgttgacctcagaa 511  Q
    |||||||||| | |||||||  || ||||||||||||||||||| |||||||||||||||||||||||  || | |||||| |||||||||||||||| |    
28575 aacattttggaagttttggaaatagcaaacaatgaattaaagggcgagttgcctgattgttggaataatctaacctcattaaaatttgttgacctcagca 28476  T
512 ataacaagttgtcaggaaagattcccttctcaatgggggnccttggtaacatggaggctt 571  Q
    ||||||| || |  ||||| |||||| |||||||||| | ||||| ||||||||||||||    
28475 ataacaaattatggggaaaaattcccatctcaatgggtgcccttgttaacatggaggctt 28416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0061; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 28171 - 28106
Alignment:
1 atcaggaggaatcccaacttgtgtaatgaattttactgcaatgactcaagacaccgtgaactcaac 66  Q
    ||||||||||||||| ||||||||||  ||||| ||| ||||| |||| |||||| ||| ||||||    
28171 atcaggaggaatccccacttgtgtaaacaatttaacttcaatggctcaggacaccatgagctcaac 28106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0017 (Bit Score: 145; Significance: 5e-76; HSPs: 6)
Name: scaffold0017
Description:

Target: scaffold0017; HSP #1
Raw Score: 145; E-Value: 5e-76
Query Start/End: Original strand, 149 - 373
Target Start/End: Original strand, 170760 - 170984
Alignment:
149 tggaaaggtgtagaccaaccttacaaagatgctgatgtgtttttaaaaagcattgatctttcaagcaaccatcttacaggggacataccagctgaaattg 248  Q
    ||||||||||||||||||   |||||| |||| |||  ||||||||||| ||||||||| ||||||||||||||||||||||| |||||| ||||||| |    
170760 tggaaaggtgtagaccaatggtacaaaaatgcagataagtttttaaaaaccattgatctctcaagcaaccatcttacaggggaaataccaactgaaatgg 170859  T
249 agtacttgtttggattgatttccttaaatttgtcaaggaacaatctcagtggggaagtcatttcaaacataggaaacttcaaatcactcgaatttcttga 348  Q
    ||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||| ||    
170860 agtacttatttggtttgatttcattaaatttgtcaaggaacaatctcagtggggaaatcattttaaacataggaaacttcaaatcacttgaatttctaga 170959  T
349 tctgtcaagaaatcatctgtcaggc 373  Q
    |||||||||||||||| ||||||||    
170960 tctgtcaagaaatcatttgtcaggc 170984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0017; HSP #2
Raw Score: 125; E-Value: 4e-64
Query Start/End: Original strand, 143 - 379
Target Start/End: Original strand, 181841 - 182077
Alignment:
143 ctgacgtggaaaggtgtagaccaaccttacaaagatgctgatgtgtttttaaaaagcattgatctttcaagcaaccatcttacaggggacataccagctg 242  Q
    |||| ||||||||||| ||||  ||  |||||| |||| |||  |||||||||||  |||||||| ||||||||| ||||||||||||| |||||| |||    
181841 ctgatgtggaaaggtgcagacagacggtacaaaaatgcagataagtttttaaaaacgattgatctctcaagcaacaatcttacaggggaaataccaactg 181940  T
243 aaattgagtacttgtttggattgatttccttaaatttgtcaaggaacaatctcagtggggaagtcatttcaaacataggaaacttcaaatcactcgaatt 342  Q
    ||||  | |||||  ||| ||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||    
181941 aaatgcaatacttagttgcattgatttcattaaatttgtcaaggaacaatctccgtggggaaatcatttcaaacataggaaacttcaagtcactcgaatt 182040  T
343 tcttgatctgtcaagaaatcatctgtcaggcagaatt 379  Q
    ||||||||||||||||||| |||||||||| ||||||    
182041 tcttgatctgtcaagaaataatctgtcaggaagaatt 182077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0017; HSP #3
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 394 - 548
Target Start/End: Original strand, 181286 - 181440
Alignment:
394 tgcaacaaaagtaagaccaacattttgggaattttggatttatcaaacaatgaattaaagggtgagttgcctgattgttggaataacttagcatcattac 493  Q
    |||| |||||||||| | | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||| | |||||||    
181286 tgcagcaaaagtaagccaagcaatttggtaattttggatttatcaagcaatgaattaaagggtgagttgcctgattgttggaatgatttaacctcattac 181385  T
494 aatttgttgacctcagaaataacaagttgtcaggaaagattcccttctcaatggg 548  Q
    ||| |||||| || || |||||||||||||| |||||||||||||||||||||||    
181386 aatatgttgatctgagcaataacaagttgtccggaaagattcccttctcaatggg 181440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0017; HSP #4
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 412 - 571
Target Start/End: Original strand, 170217 - 170376
Alignment:
412 aacattttgggaattttggatttatcaaacaatgaattaaagggtgagttgcctgattgttggaataacttagcatcattacaatttgttgacctcagaa 511  Q
    |||||||||| | |||||||  || ||||||||||||||||||| |||||||||||||||||||||||  || | |||||| |||||||||||||||| |    
170217 aacattttggaagttttggaaatagcaaacaatgaattaaagggcgagttgcctgattgttggaataatctaacctcattaaaatttgttgacctcagca 170316  T
512 ataacaagttgtcaggaaagattcccttctcaatgggggnccttggtaacatggaggctt 571  Q
    ||||||| || |  ||||| |||||| |||||||||| | ||||| ||||||||||||||    
170317 ataacaaattatggggaaaaattcccatctcaatgggtgcccttgttaacatggaggctt 170376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0017; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 181708 - 181755
Alignment:
1 atcaggaggaatcccaacttgtgtaatgaattttactgcaatgactca 48  Q
    |||||||||||||||||||||||||| |||||||||| ||||||||||    
181708 atcaggaggaatcccaacttgtgtaaagaattttacttcaatgactca 181755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0017; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 170621 - 170686
Alignment:
1 atcaggaggaatcccaacttgtgtaatgaattttactgcaatgactcaagacaccgtgaactcaac 66  Q
    ||||||||||||||| ||||||||||  ||||| ||| ||||| |||| |||||| ||| ||||||    
170621 atcaggaggaatccccacttgtgtaaacaatttaacttcaatggctcaggacaccatgagctcaac 170686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 144; Significance: 2e-75; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 148 - 379
Target Start/End: Complemental strand, 29227757 - 29227526
Alignment:
148 gtggaaaggtgtagaccaaccttacaaagatgctgatgtgtttttaaaaagcattgatctttcaagcaaccatcttacaggggacataccagctgaaatt 247  Q
    ||||||||||||| |||||| ||||||| ||||||||  ||||||||||| ||||||||| ||||||||||||||||| ||||| |||||| |||||||     
29227757 gtggaaaggtgtaaaccaacgttacaaaaatgctgataggtttttaaaaaccattgatctctcaagcaaccatcttacgggggaaataccaactgaaatg 29227658  T
248 gagtacttgtttggattgatttccttaaatttgtcaaggaacaatctcagtggggaagtcatttcaaacataggaaacttcaaatcactcgaatttcttg 347  Q
     ||  ||| |||||||||||| |||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||    
29227657 aagcgcttatttggattgattgccttaaatttgtcaaggaacaatctcagcgtggaaatcatttcaaacataggaaacttcaaatcactcgaatttcttg 29227558  T
348 atctgtcaagaaatcatctgtcaggcagaatt 379  Q
    ||||||||||||||| ||| ||||| ||||||    
29227557 atctgtcaagaaatcgtctttcaggtagaatt 29227526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 148 - 379
Target Start/End: Complemental strand, 29341056 - 29340825
Alignment:
148 gtggaaaggtgtagaccaaccttacaaagatgctgatgtgtttttaaaaagcattgatctttcaagcaaccatcttacaggggacataccagctgaaatt 247  Q
    ||||||||||||| |||||| ||||||| ||||||||  ||||||||||| ||||||||| ||||||||||||||||| ||||| |||||| |||||||     
29341056 gtggaaaggtgtaaaccaacgttacaaaaatgctgataggtttttaaaaaccattgatctctcaagcaaccatcttacgggggaaataccaactgaaatg 29340957  T
248 gagtacttgtttggattgatttccttaaatttgtcaaggaacaatctcagtggggaagtcatttcaaacataggaaacttcaaatcactcgaatttcttg 347  Q
     ||  ||| |||||||||||| |||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||    
29340956 aagcgcttatttggattgattgccttaaatttgtcaaggaacaatctcagcgtggaaatcatttcaaacataggaaacttcaaatcactcgaatttcttg 29340857  T
348 atctgtcaagaaatcatctgtcaggcagaatt 379  Q
    ||||||||||||||| ||| ||||| ||||||    
29340856 atctgtcaagaaatcgtctttcaggtagaatt 29340825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 140; Significance: 5e-73; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 140; E-Value: 5e-73
Query Start/End: Original strand, 148 - 379
Target Start/End: Original strand, 26729504 - 26729735
Alignment:
148 gtggaaaggtgtagaccaaccttacaaagatgctgatgtgtttttaaaaagcattgatctttcaagcaaccatcttacaggggacataccagctgaaatt 247  Q
    ||||||||||| ||||||||| |||||| |||| ||| |||||||||||||||||||||| ||||||||| |||||  |||||| |||||| |||||||     
26729504 gtggaaaggtgaagaccaaccctacaaaaatgcagatatgtttttaaaaagcattgatctctcaagcaactatcttttaggggaaataccaactgaaatg 26729603  T
248 gagtacttgtttggattgatttccttaaatttgtcaaggaacaatctcagtggggaagtcatttcaaacataggaaacttcaaatcactcgaatttcttg 347  Q
    ||||| ||  ||||||||||||||||||||||||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||| ||||||||||    
26729604 gagtatttagttggattgatttccttaaatttgtcaaggaacaatcttagtggggaaataatttcaaacataggaaacttcaaatcacttgaatttcttg 26729703  T
348 atctgtcaagaaatcatctgtcaggcagaatt 379  Q
    |||| ||||| |||||| ||||||| ||||||    
26729704 atctatcaagtaatcatttgtcaggaagaatt 26729735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 394 - 571
Target Start/End: Original strand, 26728935 - 26729112
Alignment:
394 tgcaacaaaagtaagaccaacattttgggaattttggatttatcaaacaatgaattaaagggtgagttgcctgattgttggaataacttagcatcattac 493  Q
    |||| |||||||||| | ||||||||||  || |||||||||||||||||| |||||||||  ||||||||||||||||||||||| |||||||||||||    
26728935 tgcagcaaaagtaagcctaacattttggcgatgttggatttatcaaacaatcaattaaaggacgagttgcctgattgttggaataatttagcatcattac 26729034  T
494 aatttgttgacctcagaaataacaagttgtcaggaaagattcccttctcaatgggggnccttggtaacatggaggctt 571  Q
    | | ||||||| | || |||||||||||||  ||||| ||||| | ||||||||| |  |||| |||||| |||||||    
26729035 actatgttgacttgagcaataacaagttgtggggaaatattccatcctcaatgggtgctcttgttaacatagaggctt 26729112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 417 - 548
Target Start/End: Original strand, 8343365 - 8343496
Alignment:
417 tttgggaattttggatttatcaaacaatgaattaaagggtgagttgcctgattgttggaataacttagcatcattacaatttgttgacctcagaaataac 516  Q
    ||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||| ||| | |||||| | | | ||||||| || ||||||    
8343365 tttgggacttttggatgtatcaaacaatgaattaaagggtgagttgcccgattgttggaataatttaacctcattatactatcttgaccttagtaataac 8343464  T
517 aagttgtcaggaaagattcccttctcaatggg 548  Q
    |||||||| ||||||||||| |||||||||||    
8343465 aagttgtcgggaaagattccattctcaatggg 8343496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 105; Significance: 4e-52; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 105; E-Value: 4e-52
Query Start/End: Original strand, 187 - 379
Target Start/End: Complemental strand, 29506371 - 29506179
Alignment:
187 gtttttaaaaagcattgatctttcaagcaaccatcttacaggggacataccagctgaaattgagtacttgtttggattgatttccttaaatttgtcaagg 286  Q
    ||||||||| ||||||||||| ||||||||||| |||| ||| || |||||| | ||||||||||||||  |||||||||  ||||||||||||||||||    
29506371 gtttttaaacagcattgatctctcaagcaaccaccttataggagaaataccaacagaaattgagtacttacttggattgacatccttaaatttgtcaagg 29506272  T
287 aacaatctcagtggggaagtcatttcaaacataggaaacttcaaatcactcgaatttcttgatctgtcaagaaatcatctgtcaggcagaatt 379  Q
    |||||||| ||||||||| | |||||| |||||||||| ||||| ||||| |||||||||||||| |||||||||||||| ||||||| ||||    
29506271 aacaatcttagtggggaaataatttcagacataggaaaattcaagtcacttgaatttcttgatctatcaagaaatcatctatcaggcacaatt 29506179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 394 - 571
Target Start/End: Complemental strand, 29506982 - 29506805
Alignment:
394 tgcaacaaaagtaagaccaacattttgggaattttggatttatcaaacaatgaattaaagggtgagttgcctgattgttggaataacttagcatcattac 493  Q
    |||||||| |||||| | |||| | ||| ||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||  || | |||||||    
29506982 tgcaacaatagtaagcctaacaatctggcaatgttggatttgtcaaacaatcaattaaagggtgagttgcctgattgttggaataatctaacctcattac 29506883  T
494 aatttgttgacctcagaaataacaagttgtcaggaaagattcccttctcaatgggggnccttggtaacatggaggctt 571  Q
    | |||||||| || || |||||||| ||||| || |||||||| ||||||||||| |  |||| ||| ||||||||||    
29506882 agtttgttgaactgagcaataacaacttgtcgggtaagattccattctcaatgggtgctcttgttaatatggaggctt 29506805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 29506560 - 29506490
Alignment:
1 atcaggaggaatcccaacttgtgtaatgaattttactgcaatgactcaagacaccgtgaactcaacttcat 71  Q
    |||||||||||||||||| ||||||| |||||||||| ||||| |||| | |||| |||||||||||||||    
29506560 atcaggaggaatcccaacatgtgtaaagaattttacttcaatggctcagggcaccatgaactcaacttcat 29506490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110656 times since January 2019
Visitors: 1335