View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-74 (Length: 619)

Name: J5-5-74
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-74
J5-5-74
[»] chr1 (2 HSPs)
chr1 (303-618)||(51071352-51071667)
chr1 (1-259)||(51071050-51071308)


Alignment Details
Target: chr1 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 303 - 618
Target Start/End: Original strand, 51071352 - 51071667
Alignment:
303 ccgatcatatttgtaccataaagcttgcagtgatcattttccctgcaaaccatcttccatgtaaggcccgctgtgcacttattgcaggttgggtattttc 402  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51071352 ccgatcatatttgtaccataaagcttgcagtgatcattttccctgcaaaccatcttccatgtaaggcccgctgtgcacttattgcaggttgggtattttc 51071451  T
403 aaatcgtaggtagacaaatccggcactcctcctgctcacagaaacaataattcaatgaaaatgtcatgattttgtagtctcataggaacataagaattac 502  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51071452 aaatcgtaggtagacaaatccggcactcctcctgctcacagaaacaataattcaatgaaaatgtcatgattttgtagtctcataggaacataagaattac 51071551  T
503 tgattaactcacttatcaacatatatatggtttaagttcccnaacttaaagcattctgcttcaacatcttcnttaacatccaaatcaaagtctggntcct 602  Q
    ||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||    
51071552 tgattaactcacttatcaacatatatatgttttaagttcccaaacttagagcattctgcttcaacatcttctttaacatccaaatcaaagtctggttcct 51071651  T
603 tctgcatcacacaatg 618  Q
    ||||||||||||||||    
51071652 tctgcatcacacaatg 51071667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 51071050 - 51071308
Alignment:
1 aactgcagctcctaaaagcagcaccttttaacttcttataagtcataagataaatcaaagttccatgtggtgggggtgtatataacataactttgttaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51071050 aactgcagctcctaaaagcagcaccttttaacttcttataagtcataagataaatcaaagttccatgtggtgggggtgtatataacataactttgttaaa 51071149  T
101 ataaaatctcaaatatttctgagaatgctaatttctgccacaggattccctatcattccaatggacccccgataactcatttgctgtctgggaatcgatc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51071150 ataaaatctcaaatatttctgagaatgctaatttctgccacaggattccctatcattccaatggacccccgataactcatttgctgtctgggaatcgatc 51071249  T
201 ctcatataactggggcacctgccatcatatgcaggatttattaaacttctggttagggg 259  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51071250 ctcatataactggggcacctgccatcatatgcaggatttattaaacttctggttagggg 51071308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 310821 times since January 2019
Visitors: 444