View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-75 (Length: 636)

Name: J5-5-75
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-75
J5-5-75
[»] chr7 (1 HSPs)
chr7 (1-579)||(248790-249365)
[»] chr8 (1 HSPs)
chr8 (144-193)||(9696028-9696077)
[»] chr3 (2 HSPs)
chr3 (148-193)||(17105255-17105300)
chr3 (148-193)||(26473302-26473347)


Alignment Details
Target: chr7 (Bit Score: 503; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 503; E-Value: 0
Query Start/End: Original strand, 1 - 579
Target Start/End: Complemental strand, 249365 - 248790
Alignment:
1 ccacaaccactatcagtgttgagggaattgtttattgtgatacctgctcaaccggcactttctctaaacacagttatctcttgccaggtatgtatgtatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
249365 ccacaaccactatcagtgttgagggaattgtttattgtgatgcctgctcaaccggcactttctctaaacacagttatctcttgccaggtatgtatgtatg 249266  T
101 taccaagtaccttgttctttctcatgcaatatacacatggttattatattcagtcacttttattttcttaaatcattaccagtgtctatgtgtatgtgtt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
249265 taccaagtaccttgttctttctcatgcaatatacacatggttattatattcagtcacttttattttcttaaatcattaccagtgtctatgtgtatgtgtt 249166  T
201 agtgtttggcgtctatgtctgaactttatatatagattataagcaaatgaatgaattgattatatatgtcaggtgttgacgttcatatagagtgcagatt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
249165 agtgtttggcgtctatgtctgaactttatatatagattataagcaaatgaatgaattgattatatatgtcaggtgttgacgttcatatagagtgcagatt 249066  T
301 tagagcaagctcaccaagaaccaacgaacagataaatttctcagtgaacagaacaacagacagagagggagcatacaaattagatataccatcagtggat 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
249065 tagagcaagctcaccaagaaccaacgaacagataaatttctcagtgaacagaacaacagacagagagggagcatacaaattagatataccatcagtggat 248966  T
401 ggaactaactgtaaaattgccatggatggtaaattcacagattgtgtctctctgccaagcaagcttggataggaacntcatcatcttcttattcttgcaa 500  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||    
248965 ggaactaactgtaaaattgccatggatggt-aattcacagattgtgtctctctgccaagcaagctt-gataggaacttcatcatcttcttattcttgcaa 248868  T
501 tgntcctttcctggaagagcaccgggaagtagtcngatattanaac-agagaataaccnatgngnatacagcctgggagc 579  Q
    || |||||| || |||||||| | |||||||||| ||||||| ||| ||||||||||| ||| | ||||||| |||||||    
248867 tgttccttt-cttgaagagca-caggaagtagtcagatattaaaacaagagaataacctatgtgtatacagcttgggagc 248790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 144 - 193
Target Start/End: Complemental strand, 9696077 - 9696028
Alignment:
144 ttatattcagtcacttttattttcttaaatcattaccagtgtctatgtgt 193  Q
    ||||||||| ||||||  |||| ||||||| |||||||||||||||||||    
9696077 ttatattcaatcacttccatttccttaaattattaccagtgtctatgtgt 9696028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 148 - 193
Target Start/End: Complemental strand, 17105300 - 17105255
Alignment:
148 attcagtcacttttattttcttaaatcattaccagtgtctatgtgt 193  Q
    ||||| |||||||||||||||||||| ||||  |||||||||||||    
17105300 attcaatcacttttattttcttaaattattattagtgtctatgtgt 17105255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 148 - 193
Target Start/End: Original strand, 26473302 - 26473347
Alignment:
148 attcagtcacttttattttcttaaatcattaccagtgtctatgtgt 193  Q
    |||||| ||||||||||||||||||  ||||| |||||||||||||    
26473302 attcagacacttttattttcttaaactattacaagtgtctatgtgt 26473347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 204203 times since January 2019
Visitors: 1518