View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-82 (Length: 200)

Name: J5-5-82
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-82
J5-5-82
[»] chr8 (1 HSPs)
chr8 (1-116)||(35339685-35339800)


Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 35339685 - 35339800
Alignment:
1 atagagtgggtgactatttaagttattggagtcgtgttgtgtttacttatccatannnnnnngtttaatttctttttatatgggttgggcattatagggt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||    
35339685 atagagtgggtgactatttaagttattggagtcgtgttgtgtttacttatccatatttttttgtttaatttctttttatatgggttgggcattatagggt 35339784  T
101 tgcattagtgcaattg 116  Q
    ||||||||||||||||    
35339785 tgcattagtgcaattg 35339800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 305762 times since January 2019
Visitors: 439