View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-90 (Length: 656)

Name: J5-5-90
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-90
J5-5-90
[»] chr8 (3 HSPs)
chr8 (235-445)||(45306256-45306466)
chr8 (1-184)||(45306022-45306205)
chr8 (442-548)||(45305886-45305992)


Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-115; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 235 - 445
Target Start/End: Original strand, 45306256 - 45306466
Alignment:
235 ttttgtgactgctcaaatgatatatgtttaaatggttgtaatcatacaagtatatatgttcttgtcacttgagttttagtatgaaatttcataatcgata 334  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45306256 ttttgtgactgctcaaatgatatatgtttaaatggttgtaatcatacaagtatatatgttcttgtcacttgagttttagtatgaaatttcataatcgata 45306355  T
335 tttacacataaattcaatcataaattctcaatacggttgatagttttttcataagaaaaaattgattgtgttacatttaaatgataaatttctagtgaac 434  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45306356 tttacacataaattcaatcataaattctcaatacggttgatagttttttcataagaaaaaattgattgtgttacatttaaatgataaatttctagtgaac 45306455  T
435 ataactcaatt 445  Q
    |||||||||||    
45306456 ataactcaatt 45306466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 184; E-Value: 3e-99
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 45306022 - 45306205
Alignment:
1 aactgctccctctttcacccttttctttgtctattttgctgtccaatctccttgcatgtacggttcaagtcgaatacttcttcttttttcacctctacga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45306022 aactgctccctctttcacccttttctttgtctattttgctgtccaatctccttgcatgtacggttcaagtcgaatacttcttcttttttcacctctacga 45306121  T
101 tctgataataccatataatgtatcttctttctcaataaaatacatacatacagtattatattaccaattctgcaactagcatgg 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45306122 tctgataataccatataatgtatcttctttctcaataaaatacatacatacagtattatattaccaattctgcaactagcatgg 45306205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 442 - 548
Target Start/End: Original strand, 45305886 - 45305992
Alignment:
442 aattctgggagattgatttgttattgggagtagagaatgaaaa-cgacgtgacgatgatgagggttatcatgagcctcatcactcattttatggntctct 540  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| | |||||    
45305886 aattctgggagattgatttgttattgggagtagagaatgaaaaacgacgtgacgatgatgagggttatcatgagcctcatcactca-tttattgttctct 45305984  T
541 tttacgtc 548  Q
    ||||||||    
45305985 tttacgtc 45305992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110830 times since January 2019
Visitors: 1335