View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-93 (Length: 723)

Name: J5-5-93
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-93
J5-5-93
[»] chr7 (2 HSPs)
chr7 (1-348)||(47984558-47984905)
chr7 (343-638)||(47983764-47984051)
[»] chr4 (2 HSPs)
chr4 (3-327)||(35115247-35115573)
chr4 (343-599)||(35116126-35116373)


Alignment Details
Target: chr7 (Bit Score: 348; Significance: 0; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 1 - 348
Target Start/End: Original strand, 47984558 - 47984905
Alignment:
1 ctagtctacatctattgtgacaaaggcttggtttgaggttaagttaatgggaatgaagaaagttcttttcttaagacttggatactcaaccgtagcatct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47984558 ctagtctacatctattgtgacaaaggcttggtttgaggttaagttaatgggaatgaagaaagttcttttcttaagacttggatactcaaccgtagcatct 47984657  T
101 gcgaaaattcgcagatcagaatgggatggaccttcaacctcatctagaaaataaggatttttcagcattgatgagtgcaaagcttagccaagaattgcat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47984658 gcgaaaattcgcagatcagaatgggatggaccttcaacctcatctagaaaataaggatttttcagcattgatgagtgcaaagcttagccaagaattgcat 47984757  T
201 tcacctgaaaaacaatataaagttgacataaactcggcaatttatcatggtggtccacctgtgccaacaagggctcccaaaatgcttaactttgtggaca 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47984758 tcacctgaaaaacaatataaagttgacataaactcggcaatttatcatggtggtccacctgtgccaacaagggctcccaaaatgcttaactttgtggaca 47984857  T
301 cagaggaaatggtaaggggtccagaggcagggccgtccctaagaattc 348  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
47984858 cagaggaaatggtaaggggtccagaggcagggccgtccctaagaattc 47984905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 198; E-Value: 1e-107
Query Start/End: Original strand, 343 - 638
Target Start/End: Original strand, 47983764 - 47984051
Alignment:
343 gaattctgtcccaggaaatggatttgtaagtcatttggtgaatttgtatcttagatgtgagtagtagacacctgcgactttggttttcctctgcccaata 442  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47983764 gaattctgtcccaggaaatggatttgtaagtcatttggtgaatttgtatcttagatgtgagtagtagacacctgcgactttggttttcctctgcccaata 47983863  T
443 ctttttcttcttctggatttttattctctgttggaatatatggttggtacatctgttttaaaaattctggtttcaaacagataaancctgcaatagagga 542  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |||||||||||||||| ||||||||||||||    
47983864 ctttttcttcttctggatttttattctctgttggaatatat-gttggtacatctg-tttaaaaattct-gtttcaaacagataaa-cctgcaatagagga 47983959  T
543 acttccatcaatttcctagagtttccngttgccncgacaatgcgcacngatgtatgggggatctgccccctgncttttgaccntaagtatnaaagg 638  Q
    |||| ||||||||| ||||||||| | |||||| ||||||||||||  ||||||| || |||||||| | || ||||||||| ||||||| |||||    
47983960 actt-catcaattt-ctagagttt-cagttgccacgacaatgcgcaacgatgtat-ggtgatctgcctcttgtcttttgaccataagtataaaagg 47984051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 272; Significance: 1e-151; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-151
Query Start/End: Original strand, 3 - 327
Target Start/End: Complemental strand, 35115573 - 35115247
Alignment:
3 agtctacatctattgtgacaaaggcttggtttgaggttaagttaatgggaatgaagaaagttcttttcttaagacttggatactcaaccgtagcatctgc 102  Q
    ||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35115573 agtctacgtctattgtgacaaaggcttggtttgaggttaagctaatgggaatgaagaaagttcttttcttaagacttggatactcaaccgtagcatctgc 35115474  T
103 gaaaattcgcagatcagaatgggatggaccttcaacctcatctagaaaataaggat--ttttcagcattgatgagtgcaaagcttagccaagaattgcat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||  |||||||||||||||||||||||||||||||||| |||||||    
35115473 gaaaattcgcagatcagaatgggatggaccttcaacctcatctagaaaatcaggattcttttcagcattgatgagtgcaaagcttagccaaggattgcat 35115374  T
201 tcacctgaaaaacaatataaagttgacataaactcggcaatttatcatggtggtccacctgtgccaacaagggctcccaaaatgcttaactttgtggaca 300  Q
    |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||    
35115373 tcacctgagaaacaatctaaagttgacataaactcggcaatttatcatggtggtccgcctgtgccaacaagggctcccaaaatgcttaattttgtcgaca 35115274  T
301 cagaggaaatggtaaggggtccagagg 327  Q
    || |||||||||| |||||||||||||    
35115273 caaaggaaatggttaggggtccagagg 35115247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 343 - 599
Target Start/End: Complemental strand, 35116373 - 35116126
Alignment:
343 gaattctgtcccaggaaatggatttgtaagtcatttggtgaatttgtatcttagatgtgagtagtagacacctgcgactttggttttcctctgcccaata 442  Q
    ||||||||||||||||||||||||| ||||||||  |||||||||||||||||||||||   |||| |||||||||||||||||||||||||||||||||    
35116373 gaattctgtcccaggaaatggatttttaagtcatgcggtgaatttgtatcttagatgtg---agtaaacacctgcgactttggttttcctctgcccaata 35116277  T
443 ctttttct-tcttctggatttttattctctgttggaatatatggttggtacatctgttttaaaaattctggtttcaaacagataaancctgcaatagagg 541  Q
    |||||| | |||| ||||||| |||||| ||||||||||||| ||||||||||||| ||||| |||||| |||||||||||||||| ||||||||||| |    
35116276 ctttttttctcttatggatttctattctttgttggaatatat-gttggtacatctg-tttaataattct-gtttcaaacagataaa-cctgcaatagaag 35116181  T
542 aacttccatcaatttcctagagtttccngttgccncgacaatgcgcacngatgtatgg 599  Q
    ||||| ||||||||| ||||||||| | |||||| |||||||| |||| |||||||||    
35116180 aactt-catcaattt-ctagagttt-cagttgccacgacaatgggcaccgatgtatgg 35116126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 201631 times since January 2019
Visitors: 1513