View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-95 (Length: 490)

Name: J5-5-95
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-95
J5-5-95
[»] chr2 (1 HSPs)
chr2 (1-403)||(8504528-8504930)


Alignment Details
Target: chr2 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 1 - 403
Target Start/End: Complemental strand, 8504930 - 8504528
Alignment:
1 aattcaataaagtatagtataatgcaagttgattcataggtaaatattgagaaagaaaatacaaatacacgattagagagtgccagttgattgtggccat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8504930 aattcaataaagtatagtataatgcaagttgattcataggtaaatattgagaaagaaaatacaaatacacgattagagagtgccagttgattgtggccat 8504831  T
101 aataaaaataccaaattatgatattccattggatttaatatggtttgttttttcttgaattttgacaaggaacttttcccctcttattattcagtcgtca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8504830 aataaaaataccaaattatgatattccattggatttaatatggtttgttttttcttgaattttgacaaggaacttttcccctcttattattcagtcgtca 8504731  T
201 aagcatacatacacaaaatgtcaatgattattcatgtgagtagttgacggatatgaatcccactaatttttctcattagatccatagaaagacagctagc 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8504730 aagcatacatacacaaaatgtcaatgattattcatgtgagtagttgacggatatgaatcccactaatttttctcattagatccatagaaagacagctagc 8504631  T
301 tagcgacttcttgtccaatctaattaaatatctccaatataggaagtcatttgcacgagttattttttgtctcatattcaaaataactatgaattttggt 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8504630 tagcgacttcttgtccaatctaattaaatatctccaatataggaagtcatttgcacgagttattttttgtctcatattcaaaataactatgaattttggt 8504531  T
401 ctc 403  Q
    |||    
8504530 ctc 8504528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 311274 times since January 2019
Visitors: 444