View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-50 (Length: 429)

Name: J5-50
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-50
J5-50
[»] chr7 (2 HSPs)
chr7 (202-429)||(47421646-47421873)
chr7 (1-150)||(47421869-47422018)


Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-125; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 202 - 429
Target Start/End: Original strand, 47421646 - 47421873
Alignment:
202 gttgcaaacatcaacaacaccttccaccacatacccttaattccttctacttctacttccaattctcatgatcaatttccacttcaaactcaaataaacc 301  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47421646 gttgcaaacatcaacaacaccttccaccacatacccttaattccttctacttctacttccaattctcatgatcaatttccacttcaaactcaaataaacc 47421745  T
302 tcttccacccatcaatattatcattgccccaccactcccctaacaccactacctttaattctaattctaattcaatcaacttccagatccaaattccacc 401  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47421746 tcttccacccatcaatattatcattgccccaccactcccctaacaccactacctttaattctaattctaattcaatcaacttccagatccaaattccacc 47421845  T
402 accgttgatcatcgattctagctggacc 429  Q
    ||||||||||||||||||||||||||||    
47421846 accgttgatcatcgattctagctggacc 47421873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 47421869 - 47422018
Alignment:
1 ggaccaaccacgaacttcttgtactcttcaagatcacatctaccatccacaatttcttcccagatcaactcatcacatgggatcatgtctcaaggtaatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47421869 ggaccaaccacgaacttcttgtactcttcaagatcacatctaccatccacaatttcttcccagatcaactcatcacatgggatcatgtctcaaggtaatt 47421968  T
101 acaattattatataaatgtttcattgatatttggttaattatgtcaattg 150  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
47421969 acaattattatataaatgtttcattgatatttggttaattatgtcaattg 47422018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108200 times since January 2019
Visitors: 1329