View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-51 (Length: 223)

Name: J5-51
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-51
J5-51
[»] chr2 (6 HSPs)
chr2 (1-223)||(1435998-1436220)
chr2 (2-214)||(1429389-1429601)
chr2 (81-214)||(21018091-21018224)
chr2 (2-223)||(1448822-1449046)
chr2 (2-223)||(1441418-1441642)
chr2 (2-184)||(1455578-1455760)
[»] chr1 (1 HSPs)
chr1 (28-175)||(43826391-43826538)


Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 1435998 - 1436220
Alignment:
1 attgttggagattttggttatgcaatgcttatggattacaaagatacccatgatactactgctgtctttggtacgattgggcatatagcacctgaatatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1435998 attgttggagattttggttatgcaatgcttatggattacaaagatacccatgatactactgctgtctttggtacgattgggcatatagcacctgaatatc 1436097  T
101 tcttaactggaaggtcttcagaaaagaccgatgtttttgcatatggtgtgatgcttcttgaactaataactggaccgagggcttctgatctagcacgtct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1436098 tcttaactggaaggtcttcagaaaagaccgatgtttttgcatatggtgtgatgcttcttgaactaataactggaccgagggcttctgatctagcacgtct 1436197  T
201 tgctgatgatgatgtgatattgc 223  Q
    |||||||||||||||||||||||    
1436198 tgctgatgatgatgtgatattgc 1436220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 2 - 214
Target Start/End: Original strand, 1429389 - 1429601
Alignment:
2 ttgttggagattttggttatgcaatgcttatggattacaaagatacccatgatactactgctgtctttggtacgattgggcatatagcacctgaatatct 101  Q
    |||| |||||||| ||||  |||| |||||||||||||||||||||||||| |||||||||||||  |||||||||||| |||||||||||||| || ||    
1429389 ttgtgggagatttcggtttagcaaagcttatggattacaaagatacccatgttactactgctgtccgtggtacgattggacatatagcacctgagtacct 1429488  T
102 cttaactggaaggtcttcagaaaagaccgatgtttttgcatatggtgtgatgcttcttgaactaataactggaccgagggcttctgatctagcacgtctt 201  Q
     | |||||||| ||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||  ||||||| ||||||||||||||||    
1429489 gtcaactggaaagtcttcagaaaagactgatgtttttggatatggtgtgatgcttcttgaactaataactggacaaagggcttttgatctagcacgtctt 1429588  T
202 gctgatgatgatg 214  Q
    ||  |||||||||    
1429589 gccaatgatgatg 1429601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 81 - 214
Target Start/End: Complemental strand, 21018224 - 21018091
Alignment:
81 gcatatagcacctgaatatctcttaactggaaggtcttcagaaaagaccgatgtttttgcatatggtgtgatgcttcttgaactaataactggaccgagg 180  Q
    ||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
21018224 gcatatagcacctgagtatctcttaactagaaggtcttcagaaaagatcgatgtttttgcatatggtgtgatgcttcttgaactaataactggaccgagg 21018125  T
181 gcttctgatctagcacgtcttgctgatgatgatg 214  Q
    |||||||| ||||||||||||||  |||||||||    
21018124 gcttctgacctagcacgtcttgccaatgatgatg 21018091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 2 - 223
Target Start/End: Original strand, 1448822 - 1449046
Alignment:
2 ttgttggagattttggttatgcaatgcttatggattacaaagatacccatgatactactgctgtctttggtacgattgggcatatagcacctgaatatct 101  Q
    ||||||||||||| ||||  |||| |||||||| |||||||||||||||||  |||||||||||    |||||  ||||||||||| ||||||| || ||    
1448822 ttgttggagatttcggtttagcaaggcttatggcttacaaagatacccatgtcactactgctgttcaaggtacacttgggcatataccacctgagtacct 1448921  T
102 cttaactggaaggtcttcagaaaagaccgatgtttttgcatatggtgtgatgcttcttgaactaataactggaccgagggcttctgatctagcacgtctt 201  Q
     | ||| |||| ||||||||||||||| |||||||||| |||||||  ||||||||||||||| | |||||||| |||||||| ||| ||||||||||||    
1448922 gtcaaccggaaagtcttcagaaaagactgatgtttttggatatggtacgatgcttcttgaactgacaactggacagagggcttttgacctagcacgtctt 1449021  T
202 gc---tgatgatgatgtgatattgc 223  Q
    ||   ||||||||||||||| ||||    
1449022 gccggtgatgatgatgtgatgttgc 1449046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 2 - 223
Target Start/End: Original strand, 1441418 - 1441642
Alignment:
2 ttgttggagattttggttatgcaatgcttatggattacaaagatacccatgatactactgctgtctttggtacgattgggcatatagcacctgaatatct 101  Q
    ||||||||||||| ||||  |||| |||||||| |||||||||||||||||  |||||||||||    |||||  ||||||||||| | ||||| || ||    
1441418 ttgttggagatttcggtttagcaaagcttatggcttacaaagatacccatgtcactactgctgttcgaggtacacttgggcatataccccctgagtacct 1441517  T
102 cttaactggaaggtcttcagaaaagaccgatgtttttgcatatggtgtgatgcttcttgaactaataactggaccgagggcttctgatctagcacgtctt 201  Q
     | ||| |||| ||||||||||||||| |||||||||| ||||||   ||||||||| ||||| | |||||||  |||||||| ||||||||||||||||    
1441518 gtcaaccggaaagtcttcagaaaagactgatgtttttggatatggcacgatgcttctagaactgacaactggaaagagggcttttgatctagcacgtctt 1441617  T
202 gc---tgatgatgatgtgatattgc 223  Q
    ||   ||||||||||||||| ||||    
1441618 gccggtgatgatgatgtgatgttgc 1441642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 2 - 184
Target Start/End: Original strand, 1455578 - 1455760
Alignment:
2 ttgttggagattttggttatgcaatgcttatggattacaaagatacccatgatactactgctgtctttggtacgattgggcatatagcacctgaatatct 101  Q
    ||||||||||||| ||||  |||| |||||||| |||||||||||||||||  |||||||||||    |||||  ||||| |||||||||| || || ||    
1455578 ttgttggagatttcggtttagcaaagcttatggcttacaaagatacccatgtcactactgctgttcaaggtacacttgggtatatagcacccgagtacct 1455677  T
102 cttaactggaaggtcttcagaaaagaccgatgtttttgcatatggtgtgatgcttcttgaactaataactggaccgagggctt 184  Q
     | ||| |||| ||||||||||||||| ||||||| || ||||||| |||||||| |||||||||||||||||| ||| ||||    
1455678 gtcaacaggaaagtcttcagaaaagactgatgtttatggatatggtatgatgctttttgaactaataactggacagagtgctt 1455760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 175
Target Start/End: Complemental strand, 43826538 - 43826391
Alignment:
28 cttatggattacaaagatacccatgatactactgctgtctttggtacgattgggcatatagcacctgaatatctcttaactggaaggtcttcagaaaaga 127  Q
    |||||||||||||| || ||||||| ||| ||||||||    ||||| |||||||||||||| || || || || |  ||||| | ||||||||| || |    
43826538 cttatggattacaaggacacccatgttacaactgctgttcggggtacaattgggcatatagctcccgagtacctatctactggcaagtcttcagagaaaa 43826439  T
128 ccgatgtttttgcatatggtgtgatgcttcttgaactaataactggac 175  Q
    | ||||||||||  |||||| | ||||||||||| || ||||||||||    
43826438 ctgatgtttttggttatggtatcatgcttcttgagcttataactggac 43826391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176050 times since January 2019
Visitors: 1578