View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-52 (Length: 541)

Name: J5-52
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-52
J5-52
[»] chr4 (2 HSPs)
chr4 (96-539)||(14864588-14865031)
chr4 (1-101)||(14864491-14864591)
[»] chr6 (2 HSPs)
chr6 (104-536)||(9363940-9364372)
chr6 (6-102)||(9364377-9364473)
[»] chr8 (2 HSPs)
chr8 (435-523)||(17539708-17539796)
chr8 (453-523)||(17009154-17009224)
[»] chr7 (1 HSPs)
chr7 (435-523)||(45828642-45828730)


Alignment Details
Target: chr4 (Bit Score: 436; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 436; E-Value: 0
Query Start/End: Original strand, 96 - 539
Target Start/End: Complemental strand, 14865031 - 14864588
Alignment:
96 caattgtggtagcattcaatggatgacctgtaagaacttccttccctagtgccacgaccacgtcccctgcctcttcctctaaagcttcctcggccaccgc 195  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14865031 caattgtggtagcattcaatggatgacctgtaagaacttccttctctagtgccacgaccacgtcccctgcctcttcctctaaagcttcctcggccaccgc 14864932  T
196 ttcttctagaaaaatttccagcatgagtcactttgagagcttactcttccttaacttgatttgacatgcgttgttcatgcactaatagtgaactttgtaa 295  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14864931 ttcttctagaaaaatttccagcatgagtcactttgagagcttactcttccttaacttgatttgacatgcgttgttcatgcactaatagtgaactttgtaa 14864832  T
296 ttcatctactggcatggtgtcgatgtcatttgattcttctattgaacatacgacatagtcaaacttagttgtcatagagcgtaaaattttctctataatt 395  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14864831 ttcatctactgacatggtgtcgatgtcatttgattcttctattgaacatacgacatagtcaaacttagttgtcatagagcgtaaaattttctctataatt 14864732  T
396 gtcacatcttccatcttctcttcatgtatcctcattcggtttgcaatcgtcaacgtccttgcaaaatactcatcaacagattctccagccttcatgtgca 495  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14864731 gtcacatcttccatcttctcttcatgtatcctcattcggtttgcaatcgtcaacgtccttgcaaaatactcatcaacagattctccagccttcatgtgca 14864632  T
496 gaatttcaaactctttacgaagagcttgtaattgagtgtgcttg 539  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
14864631 gaatttcaaactctttacgaagagcttgtaattgagtgtgcttg 14864588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 14864591 - 14864491
Alignment:
1 cttgactctactattgccttgatacttcttctttaaggagtcccatatgcctttggaagtatccttcttgagaatggtttcgagaacaactcgatcaatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14864591 cttgactctactattgccttgatacttcttctttaaggagtcccatatgcctttggaagtatccttcttgagaatggtttcgagaacaactcgatcaatt 14864492  T
101 g 101  Q
    |    
14864491 g 14864491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 309; Significance: 1e-174; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 104 - 536
Target Start/End: Original strand, 9363940 - 9364372
Alignment:
104 gtagcattcaatggatgacctgtaagaacttccttccctagtgccacgaccacgtcccctgcctcttcctctaaagcttcctcggccaccgcttcttcta 203  Q
    ||||||||||| ||||||| ||||| |||||||||| ||||||||||||||||||| ||| ||||||||||||||||||| ||| | ||| ||||||| |    
9363940 gtagcattcaaaggatgacttgtaaaaacttccttctctagtgccacgaccacgtctcctacctcttcctctaaagcttcatcgacgaccacttcttcca 9364039  T
204 gaaaaatttccagcatgagtcactttgagagcttactcttccttaacttgatttgacatgcgttgttcatgcactaatagtgaactttgtaattcatcta 303  Q
    |||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||||| |||||||||||| ||||||||||| ||||||||||||||    
9364040 gaaaaatttccagcatgagtcactttgagagcttgctcttcctcaacatgatttgacatgtgttgttcatgcattaatagtgaacattgtaattcatcta 9364139  T
304 ctggcatggtgtcgatgtcatttgattcttctattgaacatacgacatagtcaaacttagttgtcatagagcgtaaaattttctctataattgtcacatc 403  Q
    ||| ||| ||||| |||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||| || |||||||||||||||| |||||||    
9364140 ctgacatagtgtcaatgtcatttgattcttctattgaatatacgacataatcaaacttagatgtcatagagcatataattttctctataattctcacatc 9364239  T
404 ttccatcttctcttcatgtatcctcattcggtttgcaatcgtcaacgtccttgcaaaatactcatcaacagattctccagccttcatgtgcagaatttca 503  Q
    ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
9364240 ttccatcttctctccatgtatcctcatccggtttgcaatcgtcaacgtccttgcaaaatactcatcaacagattctccagctttcatgtgcagaatttca 9364339  T
504 aactctttacgaagagcttgtaattgagtgtgc 536  Q
    |||||||||| ||||||||||||||||| ||||    
9364340 aactctttacaaagagcttgtaattgagcgtgc 9364372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 6 - 102
Target Start/End: Original strand, 9364377 - 9364473
Alignment:
6 ctctactattgccttgatacttcttctttaaggagtcccatatgcctttggaagtatccttcttgagaatggtttcgagaacaactcgatcaattgt 102  Q
    |||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||| |||||||||| |||||||||||  ||||||||    
9364377 ctctactattgccttgatacttcttctttaaggagtcccatatgtcgttggaagtatcgttcttaagaatggttttgagaacaactcattcaattgt 9364473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 435 - 523
Target Start/End: Original strand, 17539708 - 17539796
Alignment:
435 tttgcaatcgtcaacgtccttgcaaaatactcatcaacagattctccagccttcatgtgcagaatttcaaactctttacgaagagcttg 523  Q
    |||||||| | ||| || |||| |||||| ||||  || ||||||||  |||||||||| ||||||||||||||||| |||||||||||    
17539708 tttgcaattgacaatgttcttgaaaaataatcattgactgattctccttccttcatgtgaagaatttcaaactctttgcgaagagcttg 17539796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 453 - 523
Target Start/End: Complemental strand, 17009224 - 17009154
Alignment:
453 cttgcaaaatactcatcaacagattctccagccttcatgtgcagaatttcaaactctttacgaagagcttg 523  Q
    |||| |||||| ||||  || ||||||||  |||||||||| ||||||||||||||||| |||||||||||    
17009224 cttgaaaaataatcattgactgattctccttccttcatgtgaagaatttcaaactctttgcgaagagcttg 17009154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 435 - 523
Target Start/End: Original strand, 45828642 - 45828730
Alignment:
435 tttgcaatcgtcaacgtccttgcaaaatactcatcaacagattctccagccttcatgtgcagaatttcaaactctttacgaagagcttg 523  Q
    |||||||| | ||| || |||| |||||| ||||  || ||||||||  |||||||||| ||||||||||||||||| |||||||||||    
45828642 tttgcaattgacaatgttcttgaaaaataatcattgactgattctccttccttcatgtgaagaatttcaaactctttgcgaagagcttg 45828730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110527 times since January 2019
Visitors: 1335