View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-55 (Length: 145)

Name: J5-55
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-55
J5-55
[»] chr4 (2 HSPs)
chr4 (58-145)||(29998352-29998439)
chr4 (1-65)||(29998435-29998499)


Alignment Details
Target: chr4 (Bit Score: 88; Significance: 1e-42; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 58 - 145
Target Start/End: Original strand, 29998352 - 29998439
Alignment:
58 tcaattgtgttttaatcttttcaatgttgcttaaaagcattagctcttgcaaagagtgaaggatttataggttctgattggttgtttg 145  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29998352 tcaattgtgttttaatcttttcaatgttgcttaaaagcattagctcttgcaaagagtgaaggatttataggttctgattggttgtttg 29998439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 65; E-Value: 6e-29
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 29998435 - 29998499
Alignment:
1 gtttgatggaccaacaagttgtgaggtcgcattcatttgatcatgggcagccttgagtcaattgt 65  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29998435 gtttgatggaccaacaagttgtgaggtcgcattcatttgatcatgggcagccttgagtcaattgt 29998499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175910 times since January 2019
Visitors: 1577