View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-56 (Length: 637)

Name: J5-56
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-56
J5-56
[»] chr2 (3 HSPs)
chr2 (1-430)||(4343204-4343633)
chr2 (425-637)||(4343629-4343841)
chr2 (191-306)||(4361469-4361583)
[»] chr8 (1 HSPs)
chr8 (36-72)||(12140641-12140677)


Alignment Details
Target: chr2 (Bit Score: 385; Significance: 0; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 385; E-Value: 0
Query Start/End: Original strand, 1 - 430
Target Start/End: Complemental strand, 4343633 - 4343204
Alignment:
1 cttaatattcgcagttgaagaaagctgattgagcctcaatcgtggtcgcagagacatcaaaaactttgatgtcgcaggcannnnnnnaaaaccttgtata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||    
4343633 cttaatattcgcagttgaagaaagctgattgagcctcaatcgtggtcgcagagacatcaaaaactttgatgtcgcaggcatttttttaaaaccttgtata 4343534  T
101 aacccttaatcatttttagagtgaaggtcgcaatagaagttgagaaacatttacacatcatattagggttagaagaacttcaacctaataatggacacat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4343533 aacccttaatcatttttagagtgaaggtcgcaatagaagttgagaaacatttacacatcatattagggttagaagaacttcaacctaataatggacacat 4343434  T
201 taattcaaatgagaaagtagaaaatgtacagtgtttcaagctcagataaggactggattgctgaagagagctgaccctccaatttcaagctaggtagttt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4343433 taattcaaatgagaaagtagaaaatgtacagtgtttcaagctcagataaggactggattgctgaagagagctgaccctccaatttcaagctaggtagttt 4343334  T
301 cctgaaagnnnnnnnntagcattattttcagattcaatatgtaatccttggattggcgcaacaaacttgaatggaacaaagaaacaaagatctaacaatt 400  Q
    ||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4343333 cctgaaagaaaaaaaatagcattattttcagattcaatatgtaatccttggattggcgcaacaaacttgaatggaacaaagaaacaaagatctaacaatt 4343234  T
401 cagttattcttgaattggagcaacgaattc 430  Q
    ||||||||||||||||||||||||||||||    
4343233 cagttattcttgaattggagcaacgaattc 4343204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 213; E-Value: 1e-116
Query Start/End: Original strand, 425 - 637
Target Start/End: Complemental strand, 4343841 - 4343629
Alignment:
425 gaattcattcaaagaaaatgattaagcaactttcacatgtcaataatcattatatgactcatgcctaatgagtacaagattcttctaaagtaaataagaa 524  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4343841 gaattcattcaaagaaaatgattaagcaactttcacatgtcaataatcattatatgactcatgcctaatgagtacaagattcttctaaagtaaataagaa 4343742  T
525 gatatgtattaaatcattaattggattaaaattttagtccaactcagatttaaattacgtgcacatgcagccaaagttttaaatcatagtagtggccacg 624  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4343741 gatatgtattaaatcattaattggattaaaattttagtccaactcagatttaaattacgtgcacatgcagccaaagttttaaatcatagtagtggccacg 4343642  T
625 ttgttgtccttaa 637  Q
    |||||||||||||    
4343641 ttgttgtccttaa 4343629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 191 - 306
Target Start/End: Complemental strand, 4361583 - 4361469
Alignment:
191 atggacacattaattcaaatgagaaagtagaaaatgtacagtgtttcaagctcagataaggactggattgctgaagagagctgaccctccaatttcaagc 290  Q
    ||||||||||||||||||| ||||| | |||||||||||| ||||||||| ||||||||||| |||||||||||||| ||||||||||||||  ||||||    
4361583 atggacacattaattcaaacgagaa-gcagaaaatgtacaatgtttcaagttcagataaggattggattgctgaagatagctgaccctccaaactcaagc 4361485  T
291 taggtagtttcctgaa 306  Q
     | |||||||||||||    
4361484 caagtagtttcctgaa 4361469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 36 - 72
Target Start/End: Original strand, 12140641 - 12140677
Alignment:
36 tcaatcgtggtcgcagagacatcaaaaactttgatgt 72  Q
    ||||||||| ||||||||||||||||||| |||||||    
12140641 tcaatcgtgatcgcagagacatcaaaaaccttgatgt 12140677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108372 times since January 2019
Visitors: 1329