View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-57 (Length: 760)

Name: J5-57
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-57
J5-57
[»] chr4 (53 HSPs)
chr4 (1-579)||(44865149-44865728)
chr4 (1-128)||(44883028-44883155)
chr4 (1-173)||(44851012-44851184)
chr4 (1-124)||(44839365-44839488)
chr4 (1-95)||(44899851-44899945)
chr4 (185-294)||(8325347-8325456)
chr4 (185-294)||(46295096-46295205)
chr4 (186-292)||(21344817-21344922)
chr4 (185-284)||(5795387-5795486)
chr4 (186-284)||(25414193-25414290)
chr4 (190-292)||(37980118-37980219)
chr4 (185-294)||(19238545-19238654)
chr4 (185-278)||(37109335-37109428)
chr4 (385-552)||(44851238-44851403)
chr4 (210-294)||(32992636-32992720)
chr4 (186-294)||(55427168-55427276)
chr4 (185-292)||(47183321-47183427)
chr4 (186-275)||(56409951-56410039)
chr4 (186-294)||(29195095-29195202)
chr4 (186-284)||(39509070-39509168)
chr4 (180-294)||(51250490-51250604)
chr4 (199-288)||(4686103-4686190)
chr4 (233-294)||(38838844-38838905)
chr4 (186-279)||(42281217-42281309)
chr4 (186-294)||(7949422-7949530)
chr4 (230-294)||(30938187-30938251)
chr4 (185-264)||(37274457-37274537)
chr4 (186-266)||(37720210-37720290)
chr4 (235-294)||(2732043-2732102)
chr4 (193-288)||(49576868-49576963)
chr4 (186-292)||(55256169-55256275)
chr4 (186-292)||(25434630-25434733)
chr4 (186-279)||(6606058-6606150)
chr4 (185-294)||(28635695-28635804)
chr4 (353-415)||(44899976-44900040)
chr4 (230-278)||(19680772-19680820)
chr4 (230-278)||(23378000-23378048)
chr4 (230-278)||(46329208-46329256)
chr4 (185-261)||(46545710-46545786)
chr4 (185-284)||(19229186-19229284)
chr4 (186-261)||(38206127-38206201)
chr4 (187-262)||(43408400-43408475)
chr4 (183-278)||(53475525-53475620)
chr4 (185-259)||(9241028-9241102)
chr4 (232-294)||(20281160-20281222)
chr4 (186-279)||(37455569-37455661)
chr4 (189-263)||(41346962-41347036)
chr4 (230-284)||(51622529-51622583)
chr4 (186-291)||(4088243-4088347)
chr4 (189-278)||(7292782-7292871)
chr4 (255-292)||(33867371-33867408)
chr4 (188-293)||(40283955-40284060)
chr4 (245-294)||(49262652-49262701)
[»] chr7 (41 HSPs)
chr7 (186-294)||(38374567-38374675)
chr7 (186-294)||(5273558-5273666)
chr7 (186-294)||(31835192-31835300)
chr7 (185-284)||(5579212-5579311)
chr7 (186-292)||(48125145-48125250)
chr7 (186-294)||(19553454-19553561)
chr7 (184-278)||(26459394-26459488)
chr7 (186-292)||(48039617-48039723)
chr7 (185-278)||(22760862-22760955)
chr7 (188-264)||(29385741-29385817)
chr7 (186-294)||(30579335-30579443)
chr7 (185-278)||(39631843-39631936)
chr7 (185-294)||(43590906-43591015)
chr7 (186-294)||(18056743-18056851)
chr7 (186-278)||(43215184-43215276)
chr7 (185-284)||(25956271-25956369)
chr7 (185-264)||(33869443-33869522)
chr7 (185-282)||(6426029-6426129)
chr7 (186-284)||(17040990-17041088)
chr7 (186-294)||(2446308-2446416)
chr7 (186-294)||(11720928-11721036)
chr7 (233-293)||(20468293-20468353)
chr7 (185-264)||(30442487-30442566)
chr7 (186-292)||(35328845-35328950)
chr7 (186-294)||(41487362-41487467)
chr7 (231-284)||(21558173-21558226)
chr7 (230-267)||(29916803-29916840)
chr7 (185-294)||(48771937-48772046)
chr7 (230-294)||(42712002-42712066)
chr7 (186-265)||(4161288-4161367)
chr7 (186-261)||(25590611-25590686)
chr7 (185-259)||(7801179-7801253)
chr7 (176-278)||(18847407-18847508)
chr7 (186-264)||(23552118-23552196)
chr7 (184-250)||(25021347-25021413)
chr7 (188-250)||(44628195-44628257)
chr7 (230-284)||(49050469-49050523)
chr7 (233-278)||(11700212-11700256)
chr7 (189-266)||(15905670-15905746)
chr7 (185-266)||(29538558-29538639)
chr7 (189-294)||(43663063-43663168)
[»] chr1 (47 HSPs)
chr1 (186-294)||(31605816-31605924)
chr1 (185-294)||(24019021-24019131)
chr1 (192-294)||(43445969-43446071)
chr1 (186-294)||(51814494-51814602)
chr1 (185-292)||(15581112-15581218)
chr1 (185-294)||(45266833-45266942)
chr1 (186-278)||(19940856-19940948)
chr1 (191-292)||(36428717-36428818)
chr1 (186-294)||(37400274-37400382)
chr1 (186-290)||(39012291-39012394)
chr1 (186-294)||(40257399-40257507)
chr1 (190-265)||(4824975-4825050)
chr1 (186-267)||(19528322-19528403)
chr1 (186-259)||(9570644-9570716)
chr1 (192-292)||(48400178-48400277)
chr1 (186-294)||(21694446-21694551)
chr1 (186-292)||(34228874-34228979)
chr1 (186-264)||(36371470-36371548)
chr1 (185-278)||(9165179-9165272)
chr1 (185-294)||(52116749-52116858)
chr1 (190-278)||(24047086-24047174)
chr1 (186-262)||(37046985-37047060)
chr1 (186-290)||(41470583-41470686)
chr1 (211-286)||(1138597-1138671)
chr1 (197-292)||(6127957-6128051)
chr1 (188-294)||(17296986-17297093)
chr1 (186-284)||(952511-952609)
chr1 (188-278)||(33700757-33700847)
chr1 (230-294)||(52029904-52029969)
chr1 (230-278)||(2799906-2799954)
chr1 (230-278)||(11063600-11063648)
chr1 (186-266)||(16169974-16170054)
chr1 (193-265)||(21273447-21273519)
chr1 (230-274)||(21392881-21392925)
chr1 (210-278)||(30203211-30203279)
chr1 (186-290)||(39714751-39714854)
chr1 (230-294)||(39966137-39966201)
chr1 (192-267)||(27430125-27430200)
chr1 (193-284)||(39964512-39964602)
chr1 (189-284)||(44486136-44486230)
chr1 (230-264)||(3265968-3266002)
chr1 (186-264)||(4566548-4566626)
chr1 (230-264)||(15786318-15786352)
chr1 (233-294)||(6650642-6650703)
chr1 (189-294)||(24730387-24730492)
chr1 (211-292)||(38939227-38939307)
chr1 (230-263)||(38947471-38947504)
[»] chr2 (33 HSPs)
chr2 (185-294)||(41908606-41908715)
chr2 (185-292)||(16525177-16525283)
chr2 (189-294)||(30359657-30359761)
chr2 (186-294)||(37480075-37480183)
chr2 (185-292)||(32106565-32106672)
chr2 (186-284)||(26482093-26482190)
chr2 (186-294)||(42327363-42327471)
chr2 (186-294)||(42602554-42602662)
chr2 (173-294)||(23052491-23052611)
chr2 (186-278)||(19016031-19016123)
chr2 (186-281)||(3697381-3697475)
chr2 (189-294)||(28966334-28966438)
chr2 (186-266)||(29503271-29503351)
chr2 (186-294)||(39714992-39715100)
chr2 (186-284)||(342395-342492)
chr2 (188-294)||(12086097-12086203)
chr2 (185-291)||(18825340-18825445)
chr2 (194-292)||(21213777-21213875)
chr2 (211-292)||(6099489-6099569)
chr2 (233-278)||(20217863-20217908)
chr2 (186-287)||(26276355-26276456)
chr2 (186-294)||(45672346-45672454)
chr2 (208-267)||(31681071-31681130)
chr2 (186-290)||(26176298-26176398)
chr2 (187-264)||(16918576-16918653)
chr2 (186-278)||(42922414-42922507)
chr2 (186-278)||(7799019-7799111)
chr2 (246-292)||(152583-152629)
chr2 (230-264)||(4262300-4262334)
chr2 (186-264)||(11251087-11251165)
chr2 (230-284)||(28194240-28194293)
chr2 (186-284)||(45672207-45672305)
chr2 (189-290)||(13747606-13747706)
[»] chr8 (33 HSPs)
chr8 (182-294)||(35287712-35287824)
chr8 (185-292)||(6530806-6530912)
chr8 (186-294)||(11793489-11793597)
chr8 (186-294)||(26688865-26688973)
chr8 (186-294)||(28783060-28783168)
chr8 (179-290)||(34778728-34778838)
chr8 (188-294)||(2203494-2203600)
chr8 (186-294)||(968362-968470)
chr8 (186-294)||(16852340-16852448)
chr8 (186-284)||(18897166-18897264)
chr8 (186-266)||(19703483-19703563)
chr8 (185-293)||(43533688-43533796)
chr8 (187-294)||(29858017-29858124)
chr8 (209-267)||(3524396-3524454)
chr8 (230-284)||(28787474-28787528)
chr8 (184-278)||(33017212-33017306)
chr8 (188-264)||(3624582-3624658)
chr8 (186-294)||(11979252-11979360)
chr8 (186-278)||(18540298-18540390)
chr8 (186-294)||(22268902-22269009)
chr8 (230-293)||(40872920-40872983)
chr8 (230-264)||(22193362-22193396)
chr8 (189-267)||(36205198-36205276)
chr8 (189-294)||(11492041-11492146)
chr8 (209-290)||(40136936-40137015)
chr8 (186-278)||(12988428-12988520)
chr8 (234-294)||(28750618-28750678)
chr8 (245-292)||(35475546-35475593)
chr8 (230-284)||(6536564-6536618)
chr8 (186-294)||(8484999-8485107)
chr8 (186-263)||(29206345-29206421)
chr8 (185-262)||(33727873-33727950)
chr8 (233-278)||(40888848-40888893)
[»] chr6 (18 HSPs)
chr6 (186-294)||(24333993-24334101)
chr6 (193-291)||(24762379-24762476)
chr6 (191-282)||(6691531-6691621)
chr6 (186-266)||(14557962-14558042)
chr6 (190-276)||(3869700-3869785)
chr6 (186-264)||(33549104-33549182)
chr6 (190-267)||(10338169-10338246)
chr6 (186-278)||(12188287-12188379)
chr6 (186-294)||(23241987-23242094)
chr6 (188-291)||(33560381-33560484)
chr6 (186-280)||(28028530-28028623)
chr6 (192-266)||(34444809-34444883)
chr6 (201-290)||(7484232-7484320)
chr6 (185-278)||(30127399-30127492)
chr6 (186-294)||(21418470-21418578)
chr6 (193-293)||(24507505-24507605)
chr6 (186-293)||(2616476-2616583)
chr6 (231-294)||(6385907-6385970)
[»] chr5 (22 HSPs)
chr5 (186-294)||(16457810-16457918)
chr5 (185-273)||(31669014-31669101)
chr5 (189-265)||(16172981-16173056)
chr5 (186-263)||(19373239-19373315)
chr5 (186-278)||(34984806-34984898)
chr5 (207-278)||(3315236-3315307)
chr5 (185-278)||(7918453-7918546)
chr5 (186-294)||(21589288-21589396)
chr5 (186-294)||(30109277-30109384)
chr5 (185-264)||(25627056-25627135)
chr5 (185-255)||(18989008-18989078)
chr5 (186-284)||(30883176-30883274)
chr5 (230-274)||(84868-84912)
chr5 (230-278)||(14285205-14285253)
chr5 (186-294)||(16773807-16773915)
chr5 (231-278)||(18595985-18596032)
chr5 (231-278)||(18974005-18974052)
chr5 (230-264)||(39327088-39327122)
chr5 (230-264)||(43442240-43442274)
chr5 (185-294)||(8278243-8278352)
chr5 (188-261)||(14656645-14656717)
chr5 (230-283)||(35360065-35360118)
[»] chr3 (48 HSPs)
chr3 (186-290)||(34844371-34844474)
chr3 (186-294)||(40268489-40268596)
chr3 (1-70)||(12925402-12925471)
chr3 (184-284)||(14186646-14186745)
chr3 (186-294)||(27923011-27923119)
chr3 (186-293)||(26871473-26871580)
chr3 (207-294)||(44069779-44069866)
chr3 (187-294)||(47454585-47454692)
chr3 (185-294)||(13164729-13164836)
chr3 (187-265)||(18316496-18316573)
chr3 (188-294)||(19716199-19716305)
chr3 (186-292)||(43303758-43303863)
chr3 (186-280)||(53863850-53863943)
chr3 (186-279)||(5499390-5499483)
chr3 (188-265)||(42799745-42799821)
chr3 (186-284)||(11092148-11092245)
chr3 (186-267)||(14270522-14270601)
chr3 (189-283)||(15034348-15034441)
chr3 (185-257)||(3054993-3055065)
chr3 (230-294)||(11612343-11612407)
chr3 (186-278)||(31520589-31520681)
chr3 (185-292)||(42430334-42430438)
chr3 (185-284)||(47810722-47810821)
chr3 (186-264)||(4222141-4222219)
chr3 (185-279)||(7207609-7207702)
chr3 (184-294)||(40777012-40777120)
chr3 (230-284)||(47236949-47237003)
chr3 (202-294)||(13347872-13347961)
chr3 (185-294)||(14339609-14339718)
chr3 (193-265)||(5166435-5166507)
chr3 (186-278)||(8051214-8051306)
chr3 (230-266)||(9345256-9345292)
chr3 (230-278)||(20501740-20501788)
chr3 (186-278)||(30232330-30232422)
chr3 (230-278)||(37788449-37788497)
chr3 (184-252)||(40286867-40286935)
chr3 (210-294)||(54990726-54990810)
chr3 (236-282)||(13174941-13174987)
chr3 (186-264)||(19154631-19154709)
chr3 (230-264)||(30311350-30311384)
chr3 (230-284)||(44743833-44743887)
chr3 (184-278)||(51903862-51903956)
chr3 (191-264)||(353155-353228)
chr3 (193-294)||(2667869-2667970)
chr3 (232-293)||(17035032-17035093)
chr3 (186-262)||(35623267-35623345)
chr3 (186-283)||(35981665-35981762)
chr3 (189-278)||(53412948-53413037)
[»] scaffold0221 (1 HSPs)
scaffold0221 (186-294)||(2877-2985)
[»] scaffold0517 (1 HSPs)
scaffold0517 (186-294)||(7694-7802)
[»] scaffold0002 (3 HSPs)
scaffold0002 (185-294)||(142152-142259)
scaffold0002 (236-282)||(132001-132047)
scaffold0002 (189-278)||(94955-95044)
[»] scaffold0258 (1 HSPs)
scaffold0258 (186-294)||(15291-15399)
[»] scaffold0236 (1 HSPs)
scaffold0236 (191-293)||(24809-24911)
[»] scaffold0189 (1 HSPs)
scaffold0189 (191-294)||(17692-17794)
[»] scaffold0194 (1 HSPs)
scaffold0194 (190-264)||(13044-13118)
[»] scaffold0291 (1 HSPs)
scaffold0291 (230-267)||(2465-2502)
[»] scaffold0337 (1 HSPs)
scaffold0337 (193-293)||(1760-1860)
[»] scaffold0172 (1 HSPs)
scaffold0172 (186-294)||(15745-15853)
[»] scaffold0032 (1 HSPs)
scaffold0032 (186-294)||(112282-112390)
[»] scaffold0238 (1 HSPs)
scaffold0238 (233-278)||(2695-2740)
[»] scaffold0187 (2 HSPs)
scaffold0187 (185-293)||(12390-12499)
scaffold0187 (185-293)||(22718-22827)
[»] scaffold0065 (1 HSPs)
scaffold0065 (193-250)||(12196-12253)


Alignment Details
Target: chr4 (Bit Score: 508; Significance: 0; HSPs: 53)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 508; E-Value: 0
Query Start/End: Original strand, 1 - 579
Target Start/End: Original strand, 44865149 - 44865728
Alignment:
1 tgctgtgggaaagcttgacaggtagagagcacctacttttttatggcagactgaaaaatcttaaaggttcaatcttgactcaagtaagttcattccacac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44865149 tgctgtgggaaagcttgacaggtagagagcacctacttttttatggcagactgaaaaatcttaaaggttcaatcttgactcaagtaagttcattccacac 44865248  T
101 aagttctcactgtttgaaatattaagattattatcattgtgttgggagtctgattatgttaggagtgctaagttatacaaattgtaacccacttgggttg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44865249 aagttctcactgtttgaaatattaagattattatcattgtgttgggagtctgattatgttaggagtgctaagttatacaaattgtaacccacttgggttg 44865348  T
201 gcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttagnnnnnn 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          
44865349 gcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttagtttttt 44865448  T
301 nnnnnnnnnaaaaaagttatacatattgtacttttcaaagtttaattatgtgttttaggttagttagagcaatgaaattagaaattggtatttcataact 400  Q
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44865449 atattttttaaaaaagttatacatattgtacttttcaaagtttaattatgtgttttaggttagttagagcaatgaaattagaaattggtatttcataact 44865548  T
401 cttgtgtgatattttaacacaacagtatgtatttcatgccaattttctacttactaactattaaattgttcaggtttgttcaaggaccctgtaattttat 500  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44865549 cttgtgtgatattttaacacaacagtatgtatttcatgccaattttctacttactaactattaaattgttcaggtttgttcaaggaccctgtaattttat 44865648  T
501 aataaacccaataaaggaacggg-tttttatgattacctatgaatcatctcagcgtgatccagaat-aagtatttaaaaaa 579  Q
    |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||    
44865649 aataaa-ccaataaaggaacgggttttttatgattacctatgaatcatctcagcgtgattcagaataaagtatttaaaaaa 44865728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 44883028 - 44883155
Alignment:
1 tgctgtgggaaagcttgacaggtagagagcacctacttttttatggcagactgaaaaatcttaaaggttcaatcttgactcaagtaagttcattccacac 100  Q
    |||||||||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||| ||||||||  ||||||| |||||||||||||||||||    
44883028 tgctgtgggaaagcttgacaggcagagagcacctacttttctatggcagacttaaaaatcttcaaggttcagccttgactaaagtaagttcattccacac 44883127  T
101 aagttctcactgtttgaaatattaagat 128  Q
    ||||||||||||||||||||||||||||    
44883128 aagttctcactgtttgaaatattaagat 44883155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 44851012 - 44851184
Alignment:
1 tgctgtgggaaagcttgacaggtagagagcacctacttttttatggcagactgaaaaatcttaaaggttcaatcttgactcaagtaagttcattccacac 100  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||| | |||||||| ||||||||||||||||     
44851012 tgctgtgggaaagcttgacaggtagagaacacctacttttttatggcagactaaagaatcttaaaggttcagttttgactcatgtaagttcattccacag 44851111  T
101 aagttctcactgtttgaaatattaagattattatcattgtgttgggagtctgattatgttaggagtgctaagt 173  Q
     |  | | ||||||| |||||||  |||||||||   |||||| ||||| |||||| ||||||| || |||||    
44851112 gaactattactgtttaaaatatttggattattattgctgtgttaggagtatgattacgttaggaatgttaagt 44851184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 44839365 - 44839488
Alignment:
1 tgctgtgggaaagcttgacaggtagagagcacctacttttttatggcagactgaaaaatcttaaaggttcaatcttgactcaagtaagttcattccacac 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||| |||||||||||||||||||||||||| || ||| |     
44839365 tgctgtgggaaagcttgacaggtagagagcacctacttttttatggaagacttaaaaaccttacaggttcaatcttgactcaagtaagttgataccatag 44839464  T
101 aagttctcactgtttgaaatatta 124  Q
     | |||| ||||||||||| ||||    
44839465 gaattcttactgtttgaaacatta 44839488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 71; E-Value: 9e-32
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 44899851 - 44899945
Alignment:
1 tgctgtgggaaagcttgacaggtagagagcacctacttttttatggcagactgaaaaatcttaaaggttcaatcttgactcaagtaagttcattc 95  Q
    ||||||||||||| |||||||||||||| ||||||||||||||||| ||||| ||||| |||||||||||| |||||||||||||||||||||||    
44899851 tgctgtgggaaagtttgacaggtagagaacacctacttttttatggtagacttaaaaaccttaaaggttcagtcttgactcaagtaagttcattc 44899945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 185 - 294
Target Start/End: Complemental strand, 8325456 - 8325347
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||||||||| | | ||||||||||||||| |||||  |||||||| ||||||||||||||||||||||||||||| ||| |||||| |||||    
8325456 taacccacttgggttgggccggtggtgttggcttgagaccttggagtgtgctcatcctcaaggtcttaggttcgattctccccggtgtcaatttgggtgg 8325357  T
285 actagtttag 294  Q
     |||||||||    
8325356 gctagtttag 8325347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 185 - 294
Target Start/End: Original strand, 46295096 - 46295205
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||| |||||| ||| | ||||||||||| | | |||  ||||||||||||||||||||| |||||||||||||||| |||||||||| |||||    
46295096 taacccacttaggttggtctggtagtgttggcttgggacattggagtgtgctcctcctcaaggtctcaggttcgattctccccggtgccaatttgggtgg 46295195  T
285 actagtttag 294  Q
     |||||||||    
46295196 gctagtttag 46295205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 186 - 292
Target Start/End: Original strand, 21344817 - 21344922
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||||||||||||||||| |||||||||| | |||||  |||||||||| |||||||||| | |||| ||||||||| ||| |||||| |||||     
21344817 aacccacttgggttggcctgatgatgttggcttgggaccttggagtgtgctcct-ctcaaggtctcatgttcaattctccccagtgtcaatttaggtggg 21344915  T
286 ctagttt 292  Q
    |||||||    
21344916 ctagttt 21344922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 185 - 284
Target Start/End: Complemental strand, 5795486 - 5795387
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||||||||| ||| |||||||| ||||   |||||  || |||||||||||||||||| ||||| |||||||||| |||||||||| |||||    
5795486 taacccacttgggttggtctggtggtgttgacttggcaccttggagtatgctcctcctcaaggtctcaggtttgattctccccagtgccaatttgggtgg 5795387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 186 - 284
Target Start/End: Complemental strand, 25414290 - 25414193
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||| ||||||||||||||  ||||||||||||||| |||||  |||||||||| ||||| |||| ||||| |||||||||| |||||||||| |||||    
25414290 aaccaacttgggttggccttctggtgttggcttgagaccttggagtgtgctcct-ctcaaagtctcaggtttgattctccccggtgccaattttggtgg 25414193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 190 - 292
Target Start/End: Complemental strand, 37980219 - 37980118
Alignment:
190 cacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactag 289  Q
    |||||||||||||||| || |||||||||| | |||||  ||||||||||| ||||||||| |||||||||||||||| ||| ||||||| | || ||||    
37980219 cacttgggttggcctggtgatgttggcttgggaccttggagtgtgctcctc-tcaaggtctcaggttcgattctccccagtgtcaatttcagcgggctag 37980121  T
290 ttt 292  Q
    |||    
37980120 ttt 37980118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 185 - 294
Target Start/End: Complemental strand, 19238654 - 19238545
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||||||||||||| |||| |||||||| | | | |  |||||||||||||| ||||||  ||||||||||||||| || ||||||| |||||    
19238654 taacccacttgggttggcctggtggtattggcttgggacttgggagtgtgctcctcctcgaggtctcgggttcgattctccccggtaccaatttgggtgg 19238555  T
285 actagtttag 294  Q
     ||| |||||    
19238554 gctaatttag 19238545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 185 - 278
Target Start/End: Complemental strand, 37109428 - 37109335
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||||||  |||| |||||||| | ||| |  ||||||||||||||||||||| ||||||||||||| |  ||||||||||    
37109428 taacccacttgggttggcctagtggtattggcttgggacctgggagtgtgctcctcctcaaggtctcaggttcgattctctctggtgccaattt 37109335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 385 - 552
Target Start/End: Original strand, 44851238 - 44851403
Alignment:
385 ttggtatttcataactcttgtgtgatattttaacacaacagtatgtatttcatgccaattttctacttactaactattaaattgttcaggtttgttcaag 484  Q
    |||||||||||| | ||||||||||||||||  ||||||| |||||||||||||  | |||| |   |||||||||||| ||||||  | ||||||||||    
44851238 ttggtatttcatgattcttgtgtgatattttgtcacaacactatgtatttcatgttagttttgt--ctactaactattacattgtttggttttgttcaag 44851335  T
485 gaccctgtaattttataataaacccaataaaggaac-gggtttttatgattacctatgaatcatctcag 552  Q
    ||| |  ||| ||||||||||| ||||| |||||||  | |||||||||||||| |||||  |||||||    
44851336 gactcaataagtttataataaa-ccaattaaggaacaagctttttatgattaccaatgaaatatctcag 44851403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 210 - 294
Target Start/End: Original strand, 32992636 - 32992720
Alignment:
210 tgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    |||||||||| | |||||  ||||||||||||||||||||| | |||||||||||||| ||| ||||||  ||||||||||||||    
32992636 tgttggcttgggaccttggagtgtgctcctcctcaaggtctcaagttcgattctccccggtgtcaatttgagtggactagtttag 32992720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 55427276 - 55427168
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| |||| |||||||| | ||| |  || ||||||| ||| |||||| |||||||||||||| | |||||||||| |||||     
55427276 aacccacttgggttggcctggtggtattggcttgggacctgggagtctgctcctgctcgaggtctcaggttcgattctccgcggtgccaatttgggtggg 55427177  T
286 ctagtttag 294  Q
    ||| |||||    
55427176 ctaatttag 55427168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 185 - 292
Target Start/End: Original strand, 47183321 - 47183427
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||  |||| |||||||||||||||||||| |||||  ||||| |||| |||||| ||| |||||||||| | ||| ||| ||||||||||||    
47183321 taacccacttaagttgacctgatggtgttggcttgagaccttggagtgtgatcct-ctcaagatctcaggttcgatttttcccggtgtcaatttcggtgg 47183419  T
285 actagttt 292  Q
    || |||||    
47183420 acaagttt 47183427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 275
Target Start/End: Original strand, 56409951 - 56410039
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaa 275  Q
    |||||||||||| ||||||| || |||||||||| | |||||  |||||||||| |||||||||| |||||||||||||||  |||||||    
56409951 aacccacttgggctggcctggtgctgttggcttgggaccttggagtgtgctcct-ctcaaggtctcaggttcgattctccctggtgccaa 56410039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 29195095 - 29195202
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| ||||||||||||| | |||||  |||||||||| |||||||||  | ||||||||||| |   ||||||||| ||| |     
29195095 aacccacttgggttggcctggtggtgttggcttgggaccttggagtgtgctcct-ctcaaggtcgcaagttcgattctctctaatgccaattttggttgg 29195193  T
286 ctagtttag 294  Q
    |||||||||    
29195194 ctagtttag 29195202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 284
Target Start/End: Original strand, 39509070 - 39509168
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||||| || |||||  ||||||| |  || |  |||||||||||||| |||||| |||||||||||||||| ||| |||||| |||||    
39509070 aacccacttgggttggtctcatggtaatggcttgggatctgggagtgtgctcctcctcgaggtctcaggttcgattctccccagtggcaatttaggtgg 39509168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 180 - 294
Target Start/End: Complemental strand, 51250604 - 51250490
Alignment:
180 aattgtaacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttc 279  Q
    ||||| |||||||||||||||||||| |||| |||||||| |  || |  ||||||||| ||||||| ||| | ||||||||| | || ||||||||||     
51250604 aattgaaacccacttgggttggcctggtggtattggcttgggatctgggagtgtgctccgcctcaagatctcaagttcgattccctccggtgccaatttg 51250505  T
280 ggtggactagtttag 294  Q
    ||||| ||| |||||    
51250504 ggtgggctaatttag 51250490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 199 - 288
Target Start/End: Complemental strand, 4686190 - 4686103
Alignment:
199 tggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggacta 288  Q
    ||||||| ||||||||||||||| |||||  |||||||||| ||||| |||| ||||| |||||| |||||||| |||||||| ||||||    
4686190 tggcctgttggtgttggcttgagaccttggagtgtgctcct-ctcaatgtctcaggtttgattct-ccctgtgcaaatttcggcggacta 4686103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 233 - 294
Target Start/End: Original strand, 38838844 - 38838905
Alignment:
233 tgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    |||||||||||||||||||||||||||||||| ||  || |||||||||||| ||| |||||    
38838844 tgctcctcctcaaggtcttaggttcgattctctccgatggcaatttcggtgggctaatttag 38838905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 279
Target Start/End: Complemental strand, 42281309 - 42281217
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttc 279  Q
    |||||||||||||||||| | ||||||||||||| | |||||  |||||||||| |||||||||| ||||| ||| | |||| ||||| |||||    
42281309 aacccacttgggttggccaggtggtgttggcttgggaccttgtagtgtgctcct-ctcaaggtctcaggtttgatcccccccggtgcctatttc 42281217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 7949530 - 7949422
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||| ||||||   ||| |||||||| | ||| |  ||||||||||||||||||||| ||||||||||||| |  ||| |||||| |||||     
7949530 aacccacttgggctggcctagcggtattggcttgggacctcggagtgtgctcctcctcaaggtctcaggttcgattctctctggtgtcaatttaggtggg 7949431  T
286 ctagtttag 294  Q
    ||| |||||    
7949430 ctaatttag 7949422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 230 - 294
Target Start/End: Complemental strand, 30938251 - 30938187
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    |||||||||||||| |||||| ||||||||||||||||  ||||||||| |||||  ||||||||    
30938251 gtgtgctcctcctcgaggtctcaggttcgattctccccaatgccaatttaggtgggttagtttag 30938187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 37274537 - 37274457
Alignment:
185 taacccacttgggttggcctgatggtg-ttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    ||||||||||||||||||||  | ||  |||||||| | ||| |  |||||||||||||||||||||||||||||||||||    
37274537 taacccacttgggttggcctagtcgtaattggcttgggacctgggagtgtgctcctcctcaaggtcttaggttcgattctc 37274457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 266
Target Start/End: Complemental strand, 37720290 - 37720210
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctccc 266  Q
    |||||||||||||||||||| || | |||||||| | ||| |  |||||| |||||||||||||  |||||||||||||||    
37720290 aacccacttgggttggcctggtgttattggcttgggacctgggagtgtgcccctcctcaaggtcccaggttcgattctccc 37720210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 235 - 294
Target Start/End: Original strand, 2732043 - 2732102
Alignment:
235 ctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    ||||||||||| |||| ||||||||||||| || |||||||||| ||||| |||||||||    
2732043 ctcctcctcaaagtctcaggttcgattctctccggtgccaatttgggtgggctagtttag 2732102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 193 - 288
Target Start/End: Complemental strand, 49576963 - 49576868
Alignment:
193 ttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggacta 288  Q
    ||||||||||||| |||| |||||||  | | | |  ||||||||||||||||||||| ||||||||||||| ||  || |||||| |||||||||    
49576963 ttgggttggcctggtggtattggctttggacttgggagtgtgctcctcctcaaggtctcaggttcgattctctccaatgtcaatttgggtggacta 49576868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 186 - 292
Target Start/End: Complemental strand, 55256275 - 55256169
Alignment:
186 aacccacttgggttgg-cctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||||| |||| |||| |||||||| | | |||  ||||||| | |||||||| || |||||||||||||| | |||||||||| |||||    
55256275 aacccacttgggttgggcctggtggtattggcttgtgacattggagtgtgcttc-cctcaaggcctcaggttcgattctcctcggtgccaattttggtgg 55256177  T
285 actagttt 292  Q
     |||||||    
55256176 gctagttt 55256169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 292
Target Start/End: Complemental strand, 25434733 - 25434630
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||| ||||||||||||| ||||| ||||||| | |||||  ||||||| || |||||||||| ||||| ||||||||| | |||||||||| ||||     
25434733 aacccaattgggttggcctggtggtg-tggcttgggaccttggagtgtgcttct-ctcaaggtctcaggtttgattctcccat-tgccaatttcagtggg 25434637  T
286 ctagttt 292  Q
    |||||||    
25434636 ctagttt 25434630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 279
Target Start/End: Original strand, 6606058 - 6606150
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttc 279  Q
    |||||||||||||||| ||||||||||||||||| | |||||  | ||| ||||  ||||| ||| |||||||||| ||||| |||| ||||||    
6606058 aacccacttgggttggtctgatggtgttggcttgggaccttggagagtgatcct-ttcaagatctcaggttcgattttccccggtgcaaatttc 6606150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 294
Target Start/End: Original strand, 28635695 - 28635804
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||||| |||| ||||  || |||| |  || |  |||||||||||||  |||||||||||||||||||| |  |||||||||| |||||    
28635695 taacccacttgggttgtcctggtggtactgacttgggatctgggagtgtgctcctcctggaggtcttaggttcgattctctctggtgccaatttgggtgg 28635794  T
285 actagtttag 294  Q
     ||| |||||    
28635795 gctaatttag 28635804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 353 - 415
Target Start/End: Original strand, 44899976 - 44900040
Alignment:
353 ttttaggttagttagagcaatgaaat--tagaaattggtatttcataactcttgtgtgatatttt 415  Q
    ||||||||||||| ||||||||||||  || ||| ||||||||||||| ||||||| ||||||||    
44899976 ttttaggttagttcgagcaatgaaattataaaaaatggtatttcataattcttgtgcgatatttt 44900040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 230 - 278
Target Start/End: Complemental strand, 19680820 - 19680772
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||| |||||||||||||||||||||||||| |  ||||||||||    
19680820 gtgtgctcttcctcaaggtcttaggttcgattctctctggtgccaattt 19680772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 230 - 278
Target Start/End: Original strand, 23378000 - 23378048
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||||||| ||||||||||||| |  ||||||||||    
23378000 gtgtgctcctcctcaaggtctcaggttcgattctctctagtgccaattt 23378048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 230 - 278
Target Start/End: Original strand, 46329208 - 46329256
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||||| | |||||||||||| ||| ||||||||||    
46329208 gtgtgctcctcctcaaggtatcaggttcgattcttcccggtgccaattt 46329256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 185 - 261
Target Start/End: Original strand, 46545710 - 46545786
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgatt 261  Q
    ||||||||||||||||||||  |||| |||||||||| |||    ||||||||||||||||| ||| || |||||||    
46545710 taacccacttgggttggcctagtggtattggcttgagacctgagagtgtgctcctcctcaagatctcagattcgatt 46545786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 284
Target Start/End: Complemental strand, 19229284 - 19229186
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||| ||||||||||||| |||| ||||| || | | | ||  ||||||||||||| |||||| |||||||||||||||  || ||||||| |||||    
19229284 taacccatttgggttggcctggtggtattggcctgggacttagaa-tgtgctcctcctcgaggtctcaggttcgattctccctggtaccaatttgggtgg 19229186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 261
Target Start/End: Complemental strand, 38206201 - 38206127
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgatt 261  Q
    ||||||||||||||| |||| ||||| ||||||| | |||||  |||||||||| |||||||||| ||||| ||||    
38206201 aacccacttgggttgacctggtggtgctggcttgggaccttggagtgtgctcct-ctcaaggtctcaggtttgatt 38206127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 262
Target Start/End: Complemental strand, 43408475 - 43408400
Alignment:
187 acccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattc 262  Q
    ||||||||  ||||| ||| |||||||| ||||||  ||||| |||||||| | |||||||||| |||||||||||    
43408475 acccacttaagttggtctggtggtgttgacttgagaacttgaagtgtgctcattctcaaggtctcaggttcgattc 43408400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 53475620 - 53475525
Alignment:
183 tgtaacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||| ||||||||| ||  ||||||||| ||| | |||||  ||||| || ||||||| || | || |||||||||||| |||||||||||    
53475620 tgtaacccagttgggttggtctagtggtgttggtttgggaccttggagtgtgatcttcctcaaagtttcagattcgattctcccatgtgccaattt 53475525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 185 - 259
Target Start/End: Complemental strand, 9241102 - 9241028
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcga 259  Q
    ||||||||||||||||||||| |||| |||||||| |  || |  |||||||||| ||| |||||| ||||||||    
9241102 taacccacttgggttggcctggtggtattggcttgggatctggtagtgtgctcctgctcgaggtctgaggttcga 9241028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 232 - 294
Target Start/End: Complemental strand, 20281222 - 20281160
Alignment:
232 gtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    ||||||||||||||||||  ||||||||| |||||| |||||| |||  |||||||| |||||    
20281222 gtgctcctcctcaaggtcccaggttcgatcctccccggtgccagtttgagtggactaatttag 20281160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 186 - 279
Target Start/End: Original strand, 37455569 - 37455661
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtcc-ttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttc 279  Q
    |||| ||||||||||||||| ||||||||||||| | || |||  || ||||||| |||||||||| ||||||||||| |||  |||||||||||    
37455569 aaccaacttgggttggcctggtggtgttggcttgggacctttggagtatgctcct-ctcaaggtctcaggttcgattc-ccctggtgccaatttc 37455661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 189 - 263
Target Start/End: Complemental strand, 41347036 - 41346962
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattct 263  Q
    |||||||||||||||||||||| |||| |||||  || |  || ||||||||||| | |||| ||||||||||||    
41347036 ccacttgggttggcctgatggtattggtttgagatctgggagtatgctcctcctcgaagtctcaggttcgattct 41346962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 230 - 284
Target Start/End: Original strand, 51622529 - 51622583
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||||||||||||| |||||||| |||| |  |||||||||| |||||    
51622529 gtgtgctcctcctcaaggtctcaggttcgactctctctggtgccaatttgggtgg 51622583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 291
Target Start/End: Original strand, 4088243 - 4088347
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||| |||||||||||   ||||||||||||||  |||||  | ||| ||||  ||||||||| ||||||||||||||   |||||||| | ||||||    
4088243 aacccatttgggttggccgcgtggtgttggcttgaaaccttggagggtggtcctt-tcaaggtctcaggttcgattctccttagtgccaatattggtgga 4088341  T
286 ctagtt 291  Q
    ||||||    
4088342 ctagtt 4088347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 7292871 - 7292782
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||| ||  |||| ||||||||   ||| |  |||||||||||||||| |||| ||||||||||||| |  ||||||||||    
7292871 ccacttgggttggtctagtggtattggcttggaacctgggagtgtgctcctcctcaaagtctcaggttcgattctctctagtgccaattt 7292782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 255 - 292
Target Start/End: Original strand, 33867371 - 33867408
Alignment:
255 ttcgattctcccctgtgccaatttcggtggactagttt 292  Q
    ||||||||||||| |||||||||||||||| |||||||    
33867371 ttcgattctccccggtgccaatttcggtgggctagttt 33867408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 293
Target Start/End: Complemental strand, 40284060 - 40283955
Alignment:
188 cccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggact 287  Q
    ||||||||||||||| ||||||| |||||||| | | | |  ||||||  ||||||||||||| ||||| |||||| |   |||||||||| ||||| ||    
40284060 cccacttgggttggcatgatggtattggcttgggacttgggagtgtgcatctcctcaaggtctaaggtttgattctgcttggtgccaatttaggtgggct 40283961  T
288 agttta 293  Q
    | ||||    
40283960 aattta 40283955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 245 - 294
Target Start/End: Complemental strand, 49262701 - 49262652
Alignment:
245 aggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    |||||| |||||||||||||||| |||||||||| ||||| ||| |||||    
49262701 aggtctcaggttcgattctccccagtgccaatttaggtgggctaatttag 49262652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 69; Significance: 1e-30; HSPs: 41)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 38374675 - 38374567
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||||||||||| || ||||||||||||| | ||||   |||||||||||||||||||||||||||||||||||||| |||||||||| |||||     
38374675 aacccacttgggttggcgtggtggtgttggcttgggaccttagagtgtgctcctcctcaaggtcttaggttcgattctccccggtgccaatttaggtggg 38374576  T
286 ctagtttag 294  Q
    |||||||||    
38374575 ctagtttag 38374567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 5273666 - 5273558
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| ||||||||||||| | ||||   ||||||||||||||||||||||||||| |||| || || |||||||||| |||||     
5273666 aacccacttgggttggcctggtggtgttggcttgggaccttagagtgtgctcctcctcaaggtcttaggtttgattgtctccggtgccaatttgggtggg 5273567  T
286 ctagtttag 294  Q
    |||||||||    
5273566 ctagtttag 5273558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 31835192 - 31835300
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| ||||||||||||| || ||||  ||||||||||||||||||||| |||||||||| ||||  |||||||||| || ||     
31835192 aacccacttgggttggcctggtggtgttggcttgggtgcttggagtgtgctcctcctcaaggtctcaggttcgattatccctggtgccaattttggcggg 31835291  T
286 ctagtttag 294  Q
    |||||||||    
31835292 ctagtttag 31835300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 185 - 284
Target Start/End: Complemental strand, 5579311 - 5579212
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||||| |||| ||||||||||||| | |||||  ||||||||||||||||||||| ||||| || ||||||| |||||||||| |||||    
5579311 taacccacttgggttgacctggtggtgttggcttgggaccttggagtgtgctcctcctcaaggtctcaggtttgactctccccggtgccaatttgggtgg 5579212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 186 - 292
Target Start/End: Complemental strand, 48125250 - 48125145
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||| ||| ||||||||||||| | |||||  ||||||||||||  ||||||| |||||| ||| ||||| ||||||||||||||||     
48125250 aacccacttgggttggtctggtggtgttggcttgggaccttggagtgtgctcctcc-gaaggtctcaggttcaattttccccggtgccaatttcggtggg 48125152  T
286 ctagttt 292  Q
    |||||||    
48125151 ctagttt 48125145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 19553454 - 19553561
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||| |||||||||||||| |||| |||||||| | ||| |  |||||||||||||||||||||||||||| ||||||||| || ||||||| |||||     
19553454 aacccgcttgggttggcctggtggtattggcttg-gacctgggagtgtgctcctcctcaaggtcttaggttcaattctccccggttccaatttaggtggg 19553552  T
286 ctagtttag 294  Q
    ||| |||||    
19553553 ctactttag 19553561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 26459488 - 26459394
Alignment:
184 gtaacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||||||||  |||| |||||||| | ||| |  ||||||||||||||||||||| ||||||||||||| |  ||||||||||    
26459488 gtaacccacttgggttggcctagtggtattggcttgggacctgggagtgtgctcctcctcaaggtctcaggttcgattctctctggtgccaattt 26459394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 186 - 292
Target Start/End: Complemental strand, 48039723 - 48039617
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| ||||||||||||| |  ||||  || ||||||| | |||||||| |||||| ||||||||  |||||||||||||| |     
48039723 aacccacttgggttggcctggtggtgttggcttgcgatcttggagtatgctccttcgcaaggtctcaggttctattctccctggtgccaatttcggttgg 48039624  T
286 ctagttt 292  Q
    |||||||    
48039623 ctagttt 48039617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 185 - 278
Target Start/End: Original strand, 22760862 - 22760955
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||| ||| |||| ||| |||| | ||| |  ||||||||||||||||||||| ||||||||||||||||  |||||||||    
22760862 taacccacttgggttggtctggtggtattgacttgggacctgggagtgtgctcctcctcaaggtctcaggttcgattctccccgatgccaattt 22760955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 188 - 264
Target Start/End: Complemental strand, 29385817 - 29385741
Alignment:
188 cccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    |||||||||||||||| ||||||||||||||| | | |||  ||||||||||||||||||||| ||||| |||||||    
29385817 cccacttgggttggccggatggtgttggcttgggactttggagtgtgctcctcctcaaggtctcaggtttgattctc 29385741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 30579335 - 30579443
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| |||| |||||||||| ||| |  |||| | |||||||||||||| |||||||||| || |  |||||||||| |||||     
30579335 aacccacttgggttggcctggtggtattggcttgagacctgggagtgtccacctcctcaaggtctcaggttcgattttctctggtgccaatttaggtggg 30579434  T
286 ctagtttag 294  Q
    ||| |||||    
30579435 ctaatttag 30579443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 185 - 278
Target Start/End: Original strand, 39631843 - 39631936
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||||||  |||| |||||||| | ||| |  ||  ||||||||||||||||| ||||||||||||| | |||||||||||    
39631843 taacccacttgggttggcctagtggtattggcttgggacctgggagtaagctcctcctcaaggtctcaggttcgattctctcttgtgccaattt 39631936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 185 - 294
Target Start/End: Original strand, 43590906 - 43591015
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||| ||||||||||||| |||| |||||||| | | | |  |||||||||||||||| |||| |||||||||||||||  |||||||||  |||||    
43590906 taacccagttgggttggcctggtggtattggcttgggacttgggagtgtgctcctcctcaatgtctcaggttcgattctccctagtgccaattaaggtgg 43591005  T
285 actagtttag 294  Q
     ||| |||||    
43591006 gctaatttag 43591015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 18056851 - 18056743
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||| | ||| |||| ||| |||| ||| | |  ||||||||||||| ||||||| |||||||||||||||| |||| ||||| |||||     
18056851 aacccacttgggttagtctggtggtattgacttgggtcttcggagtgtgctcctcctgaaggtctcaggttcgattctccccggtgctaatttgggtggg 18056752  T
286 ctagtttag 294  Q
    ||| |||||    
18056751 ctaatttag 18056743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 43215184 - 43215276
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||| ||  |||| |||||||| | ||| |  ||||||||||||||||||||| ||||||||||||| | | |||||||||    
43215184 aacccacttgggttggtctagtggtattggcttgggacctcggagtgtgctcctcctcaaggtctcaggttcgattctctcttatgccaattt 43215276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 185 - 284
Target Start/End: Complemental strand, 25956369 - 25956271
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||| ||||||||||||  |||| |||||||| | |||||  ||||||||||| |||||||||||||||| ||||||||  ||| |||| |||||||    
25956369 taacccatttgggttggcctagtggtattggcttgggaccttggagtgtgctcctc-tcaaggtcttaggttcaattctccctggtgtcaatgtcggtgg 25956271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 33869522 - 33869443
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    ||||||||||||||||||||  | || |||||||||| ||| || |||||||||| ||||||||||  ||||||||||||    
33869522 taacccacttgggttggcctagtagtattggcttgagacctggaagtgtgctccttctcaaggtctctggttcgattctc 33869443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 282
Target Start/End: Complemental strand, 6426129 - 6426029
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgc---tcctcctcaaggtcttaggttcgattctcccctgtgccaatttcgg 281  Q
    ||||||||||||||||||||| ||||||||||||| ||| |||  || |||   |||| |||||||||  ||||| |||||||| | |||||||||||||    
6426129 taacccacttgggttggcctggtggtgttggcttgggtctttggagtatgcttttcctgctcaaggtcccaggtttgattctcctcggtgccaatttcgg 6426030  T
282 t 282  Q
    |    
6426029 t 6426029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 284
Target Start/End: Complemental strand, 17041088 - 17040990
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||||| ||  |||  |||||||| |  || || ||||||||||||||||||||| ||||||||||||| |  |||||||||| |||||    
17041088 aacccacttgggttggtctagtggcattggcttgggatctggaagtgtgctcctcctcaaggtctcaggttcgattctctcaagtgccaatttgggtgg 17040990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 2446308 - 2446416
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||| |||||||| |||||||| | | | |  |||||||||||||| || ||| | ||||||||||| || ||||| |||| |||||     
2446308 aacccacttgggttggtctgatggtattggcttgggacttgggagtgtgctcctcctcgagatctcaagttcgattctctccggtgccgatttaggtggg 2446407  T
286 ctagtttag 294  Q
    ||| |||||    
2446408 ctaatttag 2446416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 11721036 - 11720928
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||| |||| |||||||||| |||| |||||||| | ||| |   |||||||||||| ||||| | || ||||||||||||| |||||||||| |||||     
11721036 aaccaacttcggttggcctggtggtattggcttgggacctgggaatgtgctcctccttaaggtatcagattcgattctccccagtgccaatttgggtggg 11720937  T
286 ctagtttag 294  Q
    ||| |||||    
11720936 ctaatttag 11720928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 233 - 293
Target Start/End: Complemental strand, 20468353 - 20468293
Alignment:
233 tgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagttta 293  Q
    ||||| ||||||||||||||||||||||||||||   ||||||||| ||||| ||||||||    
20468353 tgctcgtcctcaaggtcttaggttcgattctcccagatgccaatttgggtgggctagttta 20468293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 185 - 264
Target Start/End: Original strand, 30442487 - 30442566
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    |||||||||||||||||||   |||| |||||||| | ||| |  || |||||||||||||||||| |||||||||||||    
30442487 taacccacttgggttggcccagtggtattggcttgggacctgggagtttgctcctcctcaaggtctgaggttcgattctc 30442566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 292
Target Start/End: Complemental strand, 35328950 - 35328845
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| |||||||||||||   ||||   ||||||| || |||||||| ||||||| ||||||  || ||||||||||  ||||     
35328950 aacccacttgggttggcctggtggtgttggcttggaaccttcgagtgtgcttct-ctcaaggttttaggtttgattctttccagtgccaattttagtggg 35328852  T
286 ctagttt 292  Q
    |||||||    
35328851 ctagttt 35328845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 41487362 - 41487467
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| |||| |||||||| | | | |  |||| ||||   ||||||||| |||||||||||| ||| |||||||||| |||||     
41487362 aacccacttgggttggcctggtggtattggcttgggacttgggagtgttctcc---tcaaggtctcaggttcgattcttcccggtgccaatttaggtggg 41487458  T
286 ctagtttag 294  Q
    ||| |||||    
41487459 ctaatttag 41487467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 231 - 284
Target Start/End: Original strand, 21558173 - 21558226
Alignment:
231 tgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||||||||| ||||||||||||| |  |||||||||| |||||    
21558173 tgtgctcctcctcaaggtctcaggttcgattctctctggtgccaatttaggtgg 21558226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 230 - 267
Target Start/End: Complemental strand, 29916840 - 29916803
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccc 267  Q
    ||||||||||||||||||||| ||||||||||||||||    
29916840 gtgtgctcctcctcaaggtctcaggttcgattctcccc 29916803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 294
Target Start/End: Original strand, 48771937 - 48772046
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||||||| || |||| |||||||| |  || |  |||||||||||||  |||||| |||||||||| ||||  || ||||||| |||||    
48771937 taacccacttgggttggcttggtggtattggcttgggatctgggagtgtgctcctccttgaggtctcaggttcgattatcccaagtaccaatttaggtgg 48772036  T
285 actagtttag 294  Q
     ||| |||||    
48772037 gctaatttag 48772046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 230 - 294
Target Start/End: Original strand, 42712002 - 42712066
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    ||||||||||||||||||||| | |||||||||||||  ||| |||||| ||||| ||| |||||    
42712002 gtgtgctcctcctcaaggtctcatgttcgattctccctagtgtcaatttaggtgggctaatttag 42712066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 265
Target Start/End: Original strand, 4161288 - 4161367
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcc 265  Q
    |||||| ||||||||| ||| |||| |||||||| |  ||||| ||||||||||  | ||| ||||||||||||||||||    
4161288 aacccatttgggttggtctggtggtattggcttgggatcttgaagtgtgctccttttgaagatcttaggttcgattctcc 4161367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 261
Target Start/End: Original strand, 25590611 - 25590686
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgatt 261  Q
    ||||||||||||||| |||| |||| ||||||||||  || |  |||||||||||||| ||||||  |||||||||    
25590611 aacccacttgggttgacctgttggtattggcttgagatctgggagtgtgctcctcctcgaggtctcgggttcgatt 25590686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 185 - 259
Target Start/End: Original strand, 7801179 - 7801253
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcga 259  Q
    |||||||||||| |||||||| |||| ||| |||| | ||| |  ||||||||||| ||||||||| ||||||||    
7801179 taacccacttggtttggcctggtggtattgacttgggacctgggagtgtgctcctcttcaaggtctcaggttcga 7801253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 176 - 278
Target Start/End: Complemental strand, 18847508 - 18847407
Alignment:
176 tacaaattgtaacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaa 275  Q
    |||||| | |||||||||  |||||||||| |||||||||||||||  |||   |||||||||| |||||| ||| | ||||| ||||| || |||||||    
18847508 tacaaagtttaacccactcaggttggcctggtggtgttggcttgagatcttcgagtgtgctcct-ctcaagatctcaagttcgtttctctccggtgccaa 18847410  T
276 ttt 278  Q
    |||    
18847409 ttt 18847407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 23552118 - 23552196
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    |||||||||||||||||||  || | ||| |||| | ||| |  ||||||||||||||||||||| | |||||||||||    
23552118 aacccacttgggttggcctagtgctattgacttgggacctgggagtgtgctcctcctcaaggtctcaagttcgattctc 23552196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 184 - 250
Target Start/End: Complemental strand, 25021413 - 25021347
Alignment:
184 gtaacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtct 250  Q
    |||||||||||||||||||||  |||| |||||||| | ||| |  |||||||||||||||| ||||    
25021413 gtaacccacttgggttggcctagtggtattggcttgggacctgggagtgtgctcctcctcaaagtct 25021347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 188 - 250
Target Start/End: Complemental strand, 44628257 - 44628195
Alignment:
188 cccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtct 250  Q
    |||||||||||||||||| || |||| ||||| | |||||  |||||||||||||||| ||||    
44628257 cccacttgggttggcctggtgttgttagcttgggaccttggagtgtgctcctcctcaaagtct 44628195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 230 - 284
Target Start/End: Complemental strand, 49050523 - 49050469
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||| ||||||||  |||||| |||||||||||||||| |||||||||| |||||    
49050523 gtgtactcctccttgaggtctcaggttcgattctccccggtgccaatttaggtgg 49050469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 233 - 278
Target Start/End: Original strand, 11700212 - 11700256
Alignment:
233 tgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||||| |||||||||||| | ||||||||||||    
11700212 tgctcctcctcaaggtctcaggttcgattct-ctctgtgccaattt 11700256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 266
Target Start/End: Complemental strand, 15905746 - 15905670
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctccc 266  Q
    |||||||||||||||||  ||| |||||||| | ||| |  |||||||||||||  |||||| |||||||||||||||    
15905746 ccacttgggttggcctggcggtattggcttgggacctgggagtgtgctcctcct-taggtctcaggttcgattctccc 15905670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 266
Target Start/End: Complemental strand, 29538639 - 29538558
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctccc 266  Q
    |||||||||||||||||| |  |||||||| |||||| | |||  || | ||||| |||||||||| | |||||||||||||    
29538639 taacccacttgggttggcattgtggtgttgacttgagacattggagtatactccttctcaaggtctcaagttcgattctccc 29538558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 294
Target Start/End: Complemental strand, 43663168 - 43663063
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggacta 288  Q
    |||||||||||||||||||||| ||| |||| | ||| |  | ||| |||||||| || ||| |||||||| |||| || ||  |||||| |||||||||    
43663168 ccacttgggttggcctgatggtattgacttgggacctaggagcgtggtcctcctcgagatctcaggttcgaatctctccggtatcaatttgggtggacta 43663069  T
289 gtttag 294  Q
     |||||    
43663068 atttag 43663063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 69; Significance: 1e-30; HSPs: 47)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 31605924 - 31605816
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||  ||||||||||||||||||||||| | |||||| ||||||||||||||||||||| | |||||||||||||| |||||||||| |||||     
31605924 aacccacttatgttggcctgatggtgttggcttgggaccttgaagtgtgctcctcctcaaggtctcaagttcgattctccccggtgccaatttgggtggg 31605825  T
286 ctagtttag 294  Q
    |||||||||    
31605824 ctagtttag 31605816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 185 - 294
Target Start/End: Original strand, 24019021 - 24019131
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgat-gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtg 283  Q
    ||||||||||||||||||| |  |||||||||||| ||||||  | |||||||||||||||||||||||||||||||||||| | || ||||||||||||    
24019021 taacccacttgggttggcccggaggtgttggcttgggtcctttgtagtgtgctcctcctcaaggtcttaggttcgattctcctcggtaccaatttcggtg 24019120  T
284 gactagtttag 294  Q
    | |||||||||    
24019121 ggctagtttag 24019131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 192 - 294
Target Start/End: Original strand, 43445969 - 43446071
Alignment:
192 cttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtt 291  Q
    ||||||||||| |||||||||||||||| |||||||  ||||||||||||||||||||| | |||||||||||||| ||||||||||  |||| ||||||    
43445969 cttgggttggcttgatggtgttggcttgggtccttggagtgtgctcctcctcaaggtctcatgttcgattctccccggtgccaatttgagtgggctagtt 43446068  T
292 tag 294  Q
    |||    
43446069 tag 43446071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 51814494 - 51814602
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||||||||||||||||||| ||| ||||||  ||    ||||||||||||||||||||| ||||||||||||| || |||||||||| |||||     
51814494 aacccacttgggttggcctgatggtattgacttgagatctgagagtgtgctcctcctcaaggtctcaggttcgattctctccggtgccaatttgggtggg 51814593  T
286 ctagtttag 294  Q
    ||| |||||    
51814594 ctaatttag 51814602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 185 - 292
Target Start/End: Complemental strand, 15581218 - 15581112
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||||||||||||| ||||||||||||| | |||||  |||||||||| || ||||||| |||||| ||||||||| ||||  ||||||||||    
15581218 taacccacttgggttggcctggtggtgttggcttgggaccttggagtgtgctcct-ctaaaggtctcaggttcaattctccccggtgctgatttcggtgg 15581120  T
285 actagttt 292  Q
     |||||||    
15581119 gctagttt 15581112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 185 - 294
Target Start/End: Original strand, 45266833 - 45266942
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||| |||||||||  ||||||| |||| | | |||  || |||||||||||||||||| |||||||||||||||| |||||||||| | |||    
45266833 taacccacttgagttggcctgtcggtgttgacttggggctttggagtttgctcctcctcaaggtctcaggttcgattctccccggtgccaatttggatgg 45266932  T
285 actagtttag 294  Q
     |||||||||    
45266933 gctagtttag 45266942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 186 - 278
Target Start/End: Complemental strand, 19940948 - 19940856
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||| ||| ||||||| ||||| |||||||  ||||||||||||| ||||||| ||||| ||||||| || ||||||||||    
19940948 aacccacttgggttggtctggtggtgttagcttgggtccttggagtgtgctcctccttaaggtctcaggtttgattctctccggtgccaattt 19940856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 191 - 292
Target Start/End: Original strand, 36428717 - 36428818
Alignment:
191 acttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagt 290  Q
    ||||||||||||| | |||||||||||||   |||||  || |||||||||||||||||| | ||| |||||||||| |||||||||| ||||| |||||    
36428717 acttgggttggccgggtggtgttggcttggtaccttggagtatgctcctcctcaaggtctcatgtttgattctccccggtgccaatttgggtgggctagt 36428816  T
291 tt 292  Q
    ||    
36428817 tt 36428818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 37400274 - 37400382
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||| ||||||||||| ||| |||| |||||||||| |||  | ||||||||||||| ||||||| | ||||||||||  || |||||||||| | ||||    
37400274 aaccaacttgggttggtctggtggtattggcttgagacctgaaagtgtgctcctccttaaggtctcaagttcgattctatccggtgccaatttggatgga 37400373  T
286 ctagtttag 294  Q
    |||||||||    
37400374 ctagtttag 37400382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 186 - 290
Target Start/End: Original strand, 39012291 - 39012394
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||| |||||||||  ||||||||||||| | |||||  |||||||| || ||||||||||||||| ||||| || | ||||||||||||||||     
39012291 aacccactttggttggcctagtggtgttggcttgggaccttggagtgtgctcttc-tcaaggtcttaggtttgattcccctcggtgccaatttcggtggg 39012389  T
286 ctagt 290  Q
    |||||    
39012390 ctagt 39012394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 40257399 - 40257507
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| |||| |||||||||| ||| |  |||||||||||||| |||||| | |||| |||||  || ||| |||||| |||||     
40257399 aacccacttgggttggcctggtggtattggcttgagacctgggagtgtgctcctcctcgaggtctcaagttcaattctatccggtgtcaatttgggtggg 40257498  T
286 ctagtttag 294  Q
    |||||||||    
40257499 ctagtttag 40257507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 190 - 265
Target Start/End: Original strand, 4824975 - 4825050
Alignment:
190 cacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcc 265  Q
    |||||||||||| ||||||||||||||||| | |||||  ||||||||||| ||||||||| ||||| ||||||||    
4824975 cacttgggttggtctgatggtgttggcttgggaccttggagtgtgctcctcttcaaggtctcaggtttgattctcc 4825050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 186 - 267
Target Start/End: Complemental strand, 19528403 - 19528322
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtcct-tgatgtgtgctcctcctcaaggtcttaggttcgattctcccc 267  Q
    |||||||||||||||||||| |||| |||||||| |  || ||| ||||||||||||||||||||| ||||||||||||||||    
19528403 aacccacttgggttggcctggtggtattggcttgggatctatga-gtgtgctcctcctcaaggtctcaggttcgattctcccc 19528322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 259
Target Start/End: Original strand, 9570644 - 9570716
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcga 259  Q
    ||||||||||||||||| |||||||||||||||||| |||||  |||||||| |||||||||||| || |||||    
9570644 aacccacttgggttggc-tgatggtgttggcttgagaccttggagtgtgctcttcctcaaggtctcagattcga 9570716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 192 - 292
Target Start/End: Original strand, 48400178 - 48400277
Alignment:
192 cttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtt 291  Q
    ||||||||||||||||||| |||||||| | |||||  | |  |||||| ||||||||| |||| |||||||| || |||||||||| ||||||||||||    
48400178 cttgggttggcctgatggtattggcttgggaccttggagcgcactcctc-tcaaggtctcaggtgcgattctctccggtgccaatttaggtggactagtt 48400276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 21694446 - 21694551
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||||||||| |||| |||| |||||||||| | | |  |||||   ||||||||||||| |||||||||||| | | |||||||||| | ||||    
21694446 aacccacttgggttgacctggtggtattggcttgagacttgggagtgtg---ctcctcaaggtctcaggttcgattcttctcagtgccaatttggctgga 21694542  T
286 ctagtttag 294  Q
    |||||||||    
21694543 ctagtttag 21694551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 292
Target Start/End: Original strand, 34228874 - 34228979
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||| ||||| ||| ||||||||||||| | ||| |  ||||| |||| |||||||||| ||||| ||||||| || |||||||||| |||||     
34228874 aacccacttgagttggtctggtggtgttggcttgggacctcggagtgtgttcct-ctcaaggtctcaggttggattctctccggtgccaattttggtggg 34228972  T
286 ctagttt 292  Q
    |||||||    
34228973 ctagttt 34228979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 36371470 - 36371548
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    |||||||||||||||||||  |||| ||||||||   ||| |  ||||||||||||||||||||| |||||||||||||    
36371470 aacccacttgggttggcctagtggtattggcttggaacctgggagtgtgctcctcctcaaggtctgaggttcgattctc 36371548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 185 - 278
Target Start/End: Complemental strand, 9165272 - 9165179
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||||||  |||| |||||||| | ||| |  |||||||||||||||| |||| |||||| |||||| |  ||||||||||    
9165272 taacccacttgggttggcctagtggtattggcttgggacctgggagtgtgctcctcctcaaagtctcaggttcaattctctctggtgccaattt 9165179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 185 - 294
Target Start/End: Complemental strand, 52116858 - 52116749
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||| ||||||||||||| |||| |||||||| | | | |  |||||||||||||||| |||| |||||| ||||||||  |||||||||  |||||    
52116858 taacccagttgggttggcctggtggtattggcttgggacttgggagtgtgctcctcctcaatgtctcaggttcaattctccctagtgccaattaaggtgg 52116759  T
285 actagtttag 294  Q
     ||| |||||    
52116758 gctaatttag 52116749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 190 - 278
Target Start/End: Complemental strand, 24047174 - 24047086
Alignment:
190 cacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||| || ||||| |||||||||| | | |  |||||||||||||| |||| | | |||||||||||||| ||||||||||    
24047174 cacttgggttggtctcatggtattggcttgagacttgggagtgtgctcctcctcgaggtttcaagttcgattctccccagtgccaattt 24047086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 262
Target Start/End: Original strand, 37046985 - 37047060
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattc 262  Q
    |||||||||||||||| ||| ||||||||||||| | |||||  |||||||||| |||||||||| ||||| |||||    
37046985 aacccacttgggttggtctggtggtgttggcttgggaccttggagtgtgctcct-ctcaaggtctcaggtttgattc 37047060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 290
Target Start/End: Complemental strand, 41470686 - 41470583
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||  ||||||||| | ||||||||||||||| |||||  || ||||||| |||||||||| | ||||||||| || | ||||||||||| ||||     
41470686 aacccacacgggttggcccggtggtgttggcttgagaccttggagtatgctcct-ctcaaggtctcaagttcgattccccacagtgccaatttcagtggg 41470588  T
286 ctagt 290  Q
    |||||    
41470587 ctagt 41470583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 211 - 286
Target Start/End: Original strand, 1138597 - 1138671
Alignment:
211 gttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggac 286  Q
    |||||||||||  ||||  ||||||||||| |||||||||||||||||| |||| |  ||||||||||||||||||    
1138597 gttggcttgagatcttggagtgtgctcctc-tcaaggtcttaggttcgaatctctctagtgccaatttcggtggac 1138671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 197 - 292
Target Start/End: Complemental strand, 6128051 - 6127957
Alignment:
197 gttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagttt 292  Q
    ||||| ||| ||||||||| ||| | |||||  | ||||||||| ||||||||| | |||||||||||||| |||||||||| ||||| |||||||    
6128051 gttggtctggtggtgttggtttgggaccttggagcgtgctcctc-tcaaggtctcaagttcgattctccccggtgccaattttggtgggctagttt 6127957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 188 - 294
Target Start/End: Original strand, 17296986 - 17297093
Alignment:
188 cccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattct-cccctgtgccaatttcggtggac 286  Q
    |||||||||||||| ||  ||||| | ||||| | |||||  ||||||||||||||||||||| | ||| |||||| |||| |||||||||| ||||| |    
17296986 cccacttgggttgggcttgtggtggtagcttgggaccttggagtgtgctcctcctcaaggtctcatgtttgattctcccccggtgccaatttgggtgggc 17297085  T
287 tagtttag 294  Q
    || |||||    
17297086 taatttag 17297093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 284
Target Start/End: Original strand, 952511 - 952609
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||| ||||| ||| ||||||||||||| | ||| |  |||||||| ||||||| |||| ||||| ||||||||||  || |||||| |||||    
952511 aacccacttgagttggtctggtggtgttggcttgggacctgggagtgtgctcatcctcaaagtctcaggttagattctccccgatgtcaatttaggtgg 952609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 188 - 278
Target Start/End: Complemental strand, 33700847 - 33700757
Alignment:
188 cccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||||  |||| ||||||||    || |  ||||||||||||||||||||| ||||||||||||| |  ||||||||||    
33700847 cccacttgggttggcctagtggtattggcttggaatctgggagtgtgctcctcctcaaggtctcaggttcgattctctctggtgccaattt 33700757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 230 - 294
Target Start/End: Complemental strand, 52029969 - 52029904
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctg-tgccaatttcggtggactagtttag 294  Q
    |||||||||| |||||||||| |||||||||||||||| | ||||||||| ||||| ||| |||||    
52029969 gtgtgctccttctcaaggtctcaggttcgattctcccccgatgccaatttgggtgggctaatttag 52029904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 230 - 278
Target Start/End: Original strand, 2799906 - 2799954
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||||||| ||||||||||||| |  ||||||||||    
2799906 gtgtgctcctcctcaaggtctcaggttcgattctctctggtgccaattt 2799954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 230 - 278
Target Start/End: Original strand, 11063600 - 11063648
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||| ||||||||||||||||||||||||||||| |  ||||||||||    
11063600 gtgtgttcctcctcaaggtcttaggttcgattctctctagtgccaattt 11063648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 186 - 266
Target Start/End: Complemental strand, 16170054 - 16169974
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctccc 266  Q
    |||||||||||||| ||||| |||| ||| |||| | ||| |  ||||| ||||||||||||| | |||||||||||||||    
16170054 aacccacttgggttagcctggtggtattgacttgggacctgggagtgtgttcctcctcaaggtttcaggttcgattctccc 16169974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 193 - 265
Target Start/End: Original strand, 21273447 - 21273519
Alignment:
193 ttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcc 265  Q
    ||||| ||||||||||||||| ||||| | |||||| ||||| ||||| |||||||||  | |||||||||||    
21273447 ttgggctggcctgatggtgtttgcttgggaccttgaagtgtggtcctcttcaaggtctcggattcgattctcc 21273519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 230 - 274
Target Start/End: Original strand, 21392881 - 21392925
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgcca 274  Q
    ||||||||||||||||||||| ||||||||| |||| ||||||||    
21392881 gtgtgctcctcctcaaggtctcaggttcgatcctcctctgtgcca 21392925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 210 - 278
Target Start/End: Complemental strand, 30203279 - 30203211
Alignment:
210 tgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||| |||| |||||||| |||| |||||||||||||||| |||||| |||||| ||  |||||||||    
30203279 tgttgacttgggtccttgaagtgttctcctcctcaaggtctcaggttcaattctctccgatgccaattt 30203211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 186 - 290
Target Start/End: Complemental strand, 39714854 - 39714751
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||||||||||| |  ||| ||||||||| |  ||||  |||||||||| |||||||||| | ||| |||||||| | ||||| ||||||||||     
39714854 aacccacttgggttggcatagtggcgttggcttgggatcttggagtgtgctcct-ctcaaggtctcaagtttgattctcctcggtgccgatttcggtggg 39714756  T
286 ctagt 290  Q
    |||||    
39714755 ctagt 39714751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 230 - 294
Target Start/End: Original strand, 39966137 - 39966201
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    |||| |||||||||||||||| ||||||| |||||||| |||| ||||| ||||  |||||||||    
39966137 gtgtactcctcctcaaggtctcaggttcgtttctccccggtgctaatttgggtgtgctagtttag 39966201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 267
Target Start/End: Original strand, 27430125 - 27430200
Alignment:
192 cttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccc 267  Q
    |||||||| ||||  ||||||||||||| ||||||   | ||| |||| |||||||||| ||||||||||||||||    
27430125 cttgggttcgcctagtggtgttggcttgggtccttagagcgtgttccttctcaaggtctcaggttcgattctcccc 27430200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 193 - 284
Target Start/End: Original strand, 39964512 - 39964602
Alignment:
193 ttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||||   |||||||||||| | |||||  |||||||||| |||||||||| ||||| ||||| | |  ||||||||||||||||    
39964512 ttgggttggcctagaggtgttggcttgcgaccttggagtgtgctcct-ctcaaggtctcaggtttgattccctctggtgccaatttcggtgg 39964602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 284
Target Start/End: Complemental strand, 44486230 - 44486136
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||| |||||||  ||||||||| |||   |||||  ||||||||||| ||||||||| |  ||| ||||||||| ||||||||||||||||    
44486230 ccacttggattggcctagtggtgttggtttggaaccttggagtgtgctcctc-tcaaggtctcaaattcaattctccccggtgccaatttcggtgg 44486136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 230 - 264
Target Start/End: Original strand, 3265968 - 3266002
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    ||||||||||||||||||||| |||||||||||||    
3265968 gtgtgctcctcctcaaggtctcaggttcgattctc 3266002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 4566548 - 4566626
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    |||||||||||||||||||  || | ||||||||   ||| |  ||||||||||||||| ||||| |||||||||||||    
4566548 aacccacttgggttggcctagtgatattggcttggaacctgggagtgtgctcctcctcagggtctcaggttcgattctc 4566626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 230 - 264
Target Start/End: Complemental strand, 15786352 - 15786318
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    ||||||||||||||||||||| |||||||||||||    
15786352 gtgtgctcctcctcaaggtctcaggttcgattctc 15786318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 233 - 294
Target Start/End: Original strand, 6650642 - 6650703
Alignment:
233 tgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    ||||||||||||| |||| ||||||||||||| |  ||| |||||| |||||| ||||||||    
6650642 tgctcctcctcaatgtctcaggttcgattctctctggtgtcaatttaggtggattagtttag 6650703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 294
Target Start/End: Original strand, 24730387 - 24730492
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggacta 288  Q
    ||||||||||||||||  |||| ||| ||||||  || |  ||||||||||| ||||||||  ||||| ||| |||| | |||||||||| ||||| |||    
24730387 ccacttgggttggcctagtggtattgtcttgagatctgggagtgtgctcctcttcaaggtcccaggtttgatcctcctcggtgccaatttgggtgggcta 24730486  T
289 gtttag 294  Q
     |||||    
24730487 atttag 24730492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 211 - 292
Target Start/End: Original strand, 38939227 - 38939307
Alignment:
211 gttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagttt 292  Q
    ||||||||| | |||||  ||||||||||| |||||||||  |||| ||||||||||  || |||||||||||| |||||||    
38939227 gttggcttgggaccttggagtgtgctcctc-tcaaggtctctggtttgattctccccaatgtcaatttcggtgggctagttt 38939307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 230 - 263
Target Start/End: Complemental strand, 38947504 - 38947471
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattct 263  Q
    ||||||||||||||||||||| ||||||||||||    
38947504 gtgtgctcctcctcaaggtctcaggttcgattct 38947471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 62; Significance: 2e-26; HSPs: 33)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 185 - 294
Target Start/End: Complemental strand, 41908715 - 41908606
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||||||||||||| |||||| || ||||| |||||  ||||||||||||||||||||| | |||||||| ||||| |||||||||| |||||    
41908715 taacccacttgggttggcctggtggtgtcggtttgagaccttggagtgtgctcctcctcaaggtctcaagttcgattatccccggtgccaatttgggtgg 41908616  T
285 actagtttag 294  Q
     |||||||||    
41908615 gctagtttag 41908606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 185 - 292
Target Start/End: Original strand, 16525177 - 16525283
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||||||||||||||||||||||||||| | | |||  ||||||  ||| ||||||||| |||||||||||||||| ||||||||||||||||    
16525177 taacccacttgggttggcctgatggtgttggcttgggacgttggagtgtgcgactc-tcaaggtctcaggttcgattctccccggtgccaatttcggtgg 16525275  T
285 actagttt 292  Q
    | ||||||    
16525276 attagttt 16525283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 189 - 294
Target Start/End: Original strand, 30359657 - 30359761
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggacta 288  Q
    |||||||||||||| || ||||||||||||| | |||||  ||||||||||||||||||||| |  ||||||||||||| |||||||||| ||||| |||    
30359657 ccacttgggttggcttggtggtgttggcttgggaccttggagtgtgctcctcctcaaggtctca-tttcgattctccccagtgccaatttgggtgggcta 30359755  T
289 gtttag 294  Q
    ||||||    
30359756 gtttag 30359761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 37480075 - 37480183
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| |||| |||||||| | |||    ||||||||||||||||||||| |||||||||||||||| || ||||||| |||||     
37480075 aacccacttgggttggcctggtggtattggcttgggacctgagagtgtgctcctcctcaaggtctcaggttcgattctccccggtcccaatttgggtggg 37480174  T
286 ctagtttag 294  Q
    ||| |||||    
37480175 ctaatttag 37480183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 185 - 292
Target Start/End: Original strand, 32106565 - 32106672
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||||||||||||| |||||||| |||| | |||||  |||||||||  ||||||||||| || ||||||||| || ||||||||||| ||||    
32106565 taacccacttgggttggcctggtggtgttgacttgggaccttggagtgtgctccctctcaaggtcttgggctcgattctctccggtgccaatttcagtgg 32106664  T
285 actagttt 292  Q
     |||||||    
32106665 gctagttt 32106672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 186 - 284
Target Start/End: Original strand, 26482093 - 26482190
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||| |||||||||||||||||||||||| | ||| |  |||||||||| |||||||||| |||||||||||||| | ||||||||||| ||||    
26482093 aacccacttaggttggcctgatggtgttggcttgggacctaggagtgtgctcct-ctcaaggtctcaggttcgattctcctcagtgccaatttcagtgg 26482190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 42327471 - 42327363
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||  |||| |||||||| | ||| |  ||||||||||||||||||||| |||||||||||||  | |||||||||| |||||     
42327471 aacccacttgggttggcctagtggtattggcttgggacctgggagtgtgctcctcctcaaggtctcaggttcgattctcttcggtgccaatttgggtggg 42327372  T
286 ctagtttag 294  Q
    ||| |||||    
42327371 ctaatttag 42327363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 42602554 - 42602662
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||  |||| |||||||| | ||| |  |||||||||| |||||||||||||||| ||||||| || |||||||||| |||||     
42602554 aacccacttgggttggcctagtggtattggcttgggacctgggagtgtgctccttctcaaggtcttaggtttgattctctccggtgccaatttgggtggg 42602653  T
286 ctagtttag 294  Q
    ||| |||||    
42602654 ctaatttag 42602662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 173 - 294
Target Start/End: Complemental strand, 23052611 - 23052491
Alignment:
173 ttatacaaattgtaacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgc 272  Q
    |||||||||| ||||||||||| |||||||||| |||| |||||||| | | | |  ||||||| ||||||||||||| |||||||||||||||  ||||    
23052611 ttatacaaat-gtaacccacttaggttggcctggtggtattggcttgggacttgggagtgtgcttctcctcaaggtctcaggttcgattctccctagtgc 23052513  T
273 caatttcggtggactagtttag 294  Q
    || ||| ||||| ||| |||||    
23052512 cagtttgggtgggctaatttag 23052491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 19016031 - 19016123
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||| |||||||| |||||||||| | | |  |||||||||||||| |||||| | ||| |||||||||| ||||||||||    
19016031 aacccacttgggttggtctgatggtattggcttgagacttgggagtgtgctcctcctcgaggtctcaagtttgattctccccggtgccaattt 19016123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 3697475 - 3697381
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcgg 281  Q
    |||||||||||||||| |||||||| |||||||| | |||||  | |||||||| ||||||||||  ||||||||||||| | |||||||||||||    
3697475 aacccacttgggttggtctgatggtattggcttgggaccttggagagtgctcct-ctcaaggtctctggttcgattctcctcggtgccaatttcgg 3697381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 189 - 294
Target Start/End: Original strand, 28966334 - 28966438
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggacta 288  Q
    |||||||||||| || |||| |||||||||| |||||||  | || |||||  ||||||||| ||||||||||||||| | |||||||||| |||| |||    
28966334 ccacttgggttgacccgatgttgttggcttgggtccttggagagtactccttgtcaaggtctcaggttcgattctcccgt-tgccaatttcagtgggcta 28966432  T
289 gtttag 294  Q
    ||||||    
28966433 gtttag 28966438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 186 - 266
Target Start/End: Original strand, 29503271 - 29503351
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctccc 266  Q
    |||||||||||||||||||  |||| |||| ||| | ||| |  ||||||||||||||||||||| |||||||||||||||    
29503271 aacccacttgggttggcctagtggtattggtttgggacctgggagtgtgctcctcctcaaggtctcaggttcgattctccc 29503351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 39714992 - 39715100
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||||||||||| || |||| ||| |||| | ||| |  |||||||||||||| |||||| |||||||||||||||| |  ||||||| |||||     
39714992 aacccacttgggttggcatggtggtattgacttgggacctgggagtgtgctcctcctcgaggtctcaggttcgattctccccagcaccaatttaggtggg 39715091  T
286 ctagtttag 294  Q
    ||| |||||    
39715092 ctaatttag 39715100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 284
Target Start/End: Original strand, 342395 - 342492
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||||||||| ||||||||||||| | |||||  |||| ||| | | |||||||| | |||| ||||||| | ||||||||||||||||    
342395 aacccacttgggttggcctggtggtgttggcttgtgaccttggagtgtactcat-cgcaaggtctcaagttcaattctcctcggtgccaatttcggtgg 342492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 188 - 294
Target Start/End: Complemental strand, 12086203 - 12086097
Alignment:
188 cccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggact 287  Q
    |||||||  ||||||||| |||| |||||||| | ||| || |||||||||||||||||||||  |||||||||| | || |||| ||||| ||||| ||    
12086203 cccacttaagttggcctggtggtattggcttgggacctggaagtgtgctcctcctcaaggtctcgggttcgattccctccggtgctaatttaggtgggct 12086104  T
288 agtttag 294  Q
    | |||||    
12086103 aatttag 12086097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 291
Target Start/End: Original strand, 18825340 - 18825445
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||||  |||| ||||||||||||| | ||| |  |||||||||| |||||||||| | ||| |||| ||||| |||||||||||||| |    
18825340 taacccacttgggtttacctggtggtgttggcttgggacctaggagtgtgctcct-ctcaaggtctcaagtttgattttccccggtgccaatttcggtag 18825438  T
285 actagtt 291  Q
     ||||||    
18825439 gctagtt 18825445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 194 - 292
Target Start/End: Original strand, 21213777 - 21213875
Alignment:
194 tgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagttt 292  Q
    |||||||| ||| |||| |||||||| | ||| |  ||||| |||||||  |||||| |||||||||||||||| |||||||||| ||||| |||||||    
21213777 tgggttggtctggtggtattggcttgggacctgggagtgtgttcctccttgaggtctcaggttcgattctccccggtgccaatttaggtgggctagttt 21213875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 211 - 292
Target Start/End: Complemental strand, 6099569 - 6099489
Alignment:
211 gttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagttt 292  Q
    ||||||||| | |||||  ||||||||||| ||||||||| ||||||||||||||||  ||||||| ||||||| |||||||    
6099569 gttggcttgggaccttggagtgtgctcctc-tcaaggtctcaggttcgattctccccgctgccaatatcggtgggctagttt 6099489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 233 - 278
Target Start/End: Original strand, 20217863 - 20217908
Alignment:
233 tgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||||||||||||||||| || |||||||||||    
20217863 tgctcctcctcaaggtcttaggttcgattcttccatgtgccaattt 20217908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 287
Target Start/End: Original strand, 26276355 - 26276456
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||| | |||| ||  |||||||||||| | |||||  ||||||||||||||||||||| ||||||| |||||  | ||| |||||| ||||||    
26276355 aacccacttgaggtggcttgccggtgttggcttggggccttgtagtgtgctcctcctcaaggtctcaggttcgtttctcgtcggtgtcaatttaggtgga 26276454  T
286 ct 287  Q
    ||    
26276455 ct 26276456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 45672454 - 45672346
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||  |||| ||| |||||| |||||  || || |||||||| |||||| |||||| ||||||| | ||| |||||| |||||     
45672454 aacccacttgggttggccttgtggttttgccttgagaccttggagtatgttcctcctctaggtctcaggttcaattctcctccgtgtcaatttgggtggg 45672355  T
286 ctagtttag 294  Q
     ||||||||    
45672354 ttagtttag 45672346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 208 - 267
Target Start/End: Original strand, 31681071 - 31681130
Alignment:
208 ggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccc 267  Q
    |||||||||||||| |||||  ||||||| |||||||| |||| ||||||||||||||||    
31681071 ggtgttggcttgagaccttggagtgtgcttctcctcaaagtctcaggttcgattctcccc 31681130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 290
Target Start/End: Complemental strand, 26176398 - 26176298
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||| |||||||||||||||   |||||| |||| | |||||  ||||||||||| ||||||||| || ||||||||||||  |||||||||| |||||     
26176398 aacctacttgggttggcctg---gtgttgacttgggaccttggggtgtgctcctc-tcaaggtctcagattcgattctccctggtgccaattttggtggc 26176303  T
286 ctagt 290  Q
    |||||    
26176302 ctagt 26176298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 264
Target Start/End: Complemental strand, 16918653 - 16918576
Alignment:
187 acccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    ||||||||||||||||||  |||| |||| ||| |  || |  ||||||||||||||||||||||||||| |||||||    
16918653 acccacttgggttggcctagtggtattggtttgggatctgggagtgtgctcctcctcaaggtcttaggttggattctc 16918576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 42922414 - 42922507
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctc-aaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||||||  |||| ||||||||   ||| |  |||||||||||||| ||||||| ||||||||||||| |  ||||||||||    
42922414 aacccacttgggttggcctagtggtattggcttggaacctgggagtgtgctcctcctcaaaggtctcaggttcgattctctctggtgccaattt 42922507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 186 - 278
Target Start/End: Complemental strand, 7799111 - 7799019
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||| |||| |||| |||||||| | | | |  |||||||||||||| || ||| || |||||||||| || ||||||||||    
7799111 aacccacttgggttgtcctggtggtattggcttgggacttgggagtgtgctcctcctcgagatctcagattcgattctctccagtgccaattt 7799019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 246 - 292
Target Start/End: Original strand, 152583 - 152629
Alignment:
246 ggtcttaggttcgattctcccctgtgccaatttcggtggactagttt 292  Q
    |||||||||||||||||| ||||||| ||||||  ||||||||||||    
152583 ggtcttaggttcgattctaccctgtgtcaatttttgtggactagttt 152629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 230 - 264
Target Start/End: Complemental strand, 4262334 - 4262300
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    ||||||||||||||||||||| |||||||||||||    
4262334 gtgtgctcctcctcaaggtctcaggttcgattctc 4262300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 11251087 - 11251165
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    ||||||||| ||||||| |  |||| |||||||| | | | || ||||||||||||||||||||| ||||| |||||||    
11251087 aacccacttaggttggcttagtggtattggcttgggacttggaagtgtgctcctcctcaaggtctcaggtttgattctc 11251165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 230 - 284
Target Start/End: Complemental strand, 28194293 - 28194240
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||| | ||||||||||||||||||||| |  ||||||||||||||||    
28194293 gtgtgctcctctt-aaggtcttaggttcgattctctctggtgccaatttcggtgg 28194240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 186 - 284
Target Start/End: Complemental strand, 45672305 - 45672207
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||| |||||||  |||| ||| |||||| |||||  || || |||||||| |||||| |||||| ||||||| | ||| |||||| |||||    
45672305 aacccacttggattggccttgtggttttgccttgagaccttggagtatgttcctcctctaggtctcaggttcaattctcctccgtgtcaatttgggtgg 45672207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 290
Target Start/End: Complemental strand, 13747706 - 13747606
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggacta 288  Q
    ||||| |||||||| |  ||||||||||||| | |||||  || ||||||||| |||||||| ||||| || || |||| ||||| |||||||||| |||    
13747706 ccactggggttggcttagtggtgttggcttgggaccttggagtatgctcctcc-caaggtctcaggtttgaatccccccggtgccgatttcggtgggcta 13747608  T
289 gt 290  Q
    ||    
13747607 gt 13747606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 61; Significance: 9e-26; HSPs: 33)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 182 - 294
Target Start/End: Original strand, 35287712 - 35287824
Alignment:
182 ttgtaacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcgg 281  Q
    ||||||||||||||||| |||||| |||||||||||||||   |||  ||||||||||||||||||| | | ||||||||||| || |||||||||| ||    
35287712 ttgtaacccacttgggtaggcctggtggtgttggcttgagattttggagtgtgctcctcctcaaggtatcatgttcgattctctccggtgccaatttggg 35287811  T
282 tggactagtttag 294  Q
    |||||||||||||    
35287812 tggactagtttag 35287824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 185 - 292
Target Start/End: Original strand, 6530806 - 6530912
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||||||||||||| ||||||||||||| | ||| |  ||||||||||| |||| |||| |||||||||||||||| |||||||| |||||||    
6530806 taacccacttgggttggcctggtggtgttggcttgggacctaggagtgtgctcctc-tcaatgtctcaggttcgattctccccggtgccaatatcggtgg 6530904  T
285 actagttt 292  Q
    ||||||||    
6530905 actagttt 6530912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 11793597 - 11793489
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||| ||  ||||||| ||||| | |||||  ||||||||||||||||||||||||||| |||||| ||| |||||||||| |||||     
11793597 aacccacttgggttggtcttgtggtgttcgcttgggaccttggagtgtgctcctcctcaaggtcttaggtttgattcttcccggtgccaatttgggtggg 11793498  T
286 ctagtttag 294  Q
    |||||||||    
11793497 ctagtttag 11793489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 26688865 - 26688973
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| ||||||||||||| | |||||  ||||||||||||||||||||| ||||||  |||| ||  ||| |||||| |||||     
26688865 aacccacttgggttggcctggtggtgttggcttgggaccttggagtgtgctcctcctcaaggtctcaggttcagttcttcctagtgtcaatttgggtggg 26688964  T
286 ctagtttag 294  Q
    |||||||||    
26688965 ctagtttag 26688973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 28783060 - 28783168
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||||||||||| || |||| |||||||||| ||| |  ||||||||||||||||||||| | |||||||||||| | |||||||||| |||||     
28783060 aacccacttgggttggcttggtggtattggcttgagacctgggagtgtgctcctcctcaaggtctcatgttcgattctcctcggtgccaatttgggtggg 28783159  T
286 ctagtttag 294  Q
    ||| |||||    
28783160 ctaatttag 28783168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 179 - 290
Target Start/End: Original strand, 34778728 - 34778838
Alignment:
179 aaattgtaacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||||||| ||||| ||||||||||||||| |||||  ||||||||||  ||||||||| | ||| |||| ||| | ||||||||||    
34778728 aaattgtaacccacttgggtttgcctggtggtgttggcttgagaccttgcagtgtgctcct-ttcaaggtctcaagtttgattttccacggtgccaattt 34778826  T
279 cggtggactagt 290  Q
    |||||| |||||    
34778827 cggtgggctagt 34778838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 188 - 294
Target Start/End: Original strand, 2203494 - 2203600
Alignment:
188 cccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggact 287  Q
    |||||||||||||||||  |||| |||||||| | ||| |  ||||||||||||||||||||| ||| || ||||||||| |||||||||| ||||| ||    
2203494 cccacttgggttggcctagtggtattggcttgggacctgggagtgtgctcctcctcaaggtctcagggtcaattctccccggtgccaatttgggtgggct 2203593  T
288 agtttag 294  Q
    | |||||    
2203594 aatttag 2203600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 968362 - 968470
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||| ||||||||| |||| |||||||| | ||| |  |||||||||||||| |||||| ||||||||||||| ||  ||||||||| |||||     
968362 aacccacttgagttggcctggtggtattggcttgggacctgggagtgtgctcctcctcgaggtctcaggttcgattctctccgatgccaatttaggtggg 968461  T
286 ctagtttag 294  Q
    ||| |||||    
968462 ctaatttag 968470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 16852340 - 16852448
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||  |||| |||||||| | ||| |  |||||||||||||| |||||| ||||||||||||||   |||||||||| |||||     
16852340 aacccacttgggttggcctagtggtattggcttgggacctgggagtgtgctcctcctcgaggtctcaggttcgattctccttagtgccaatttaggtggg 16852439  T
286 ctagtttag 294  Q
    ||| |||||    
16852440 ctattttag 16852448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 186 - 284
Target Start/End: Original strand, 18897166 - 18897264
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||||||||  ||||||||| ||| | ||||   ||||||||||||||||||||| | |||||||||| ||  |||||||||| |||||    
18897166 aacccacttgggttggcctagtggtgttggtttgggaccttagagtgtgctcctcctcaaggtctcatgttcgattcttcctggtgccaatttaggtgg 18897264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 186 - 266
Target Start/End: Complemental strand, 19703563 - 19703483
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctccc 266  Q
    |||||||||||||||||||  |||| |||||||| | |||    ||||||||||||||||||||| |||||||||||||||    
19703563 aacccacttgggttggcctagtggtattggcttgggacctgagagtgtgctcctcctcaaggtctcaggttcgattctccc 19703483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 185 - 293
Target Start/End: Complemental strand, 43533796 - 43533688
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||| |  ||| ||||||||||||||| |||||  |||||||  |||||||||||| | |||| ||||||||| | || ||||| |||||    
43533796 taacccacttgggtggatctggtggtgttggcttgagaccttggagtgtgcttatcctcaaggtctcacgttcaattctccccggcgctaatttgggtgg 43533697  T
285 actagttta 293  Q
    |||| ||||    
43533696 actaattta 43533688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 187 - 294
Target Start/End: Complemental strand, 29858124 - 29858017
Alignment:
187 acccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggac 286  Q
    |||||||||| |||||||| |||| |||||||| | ||  |  |||||||||||||| |||||| ||||||||||| || | |||||||||| ||||| |    
29858124 acccacttggattggcctggtggtattggcttgggaccagggagtgtgctcctcctcgaggtctcaggttcgattcccctcggtgccaatttaggtgggc 29858025  T
287 tagtttag 294  Q
    || |||||    
29858024 taatttag 29858017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 209 - 267
Target Start/End: Complemental strand, 3524454 - 3524396
Alignment:
209 gtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccc 267  Q
    ||||||||||| | |||||  |||||||||||||||||||||||||||| |||||||||    
3524454 gtgttggcttgggaccttggagtgtgctcctcctcaaggtcttaggttcaattctcccc 3524396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 230 - 284
Target Start/End: Complemental strand, 28787528 - 28787474
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||||||||||||| ||||| |||||||||| |||||||||| |||||    
28787528 gtgtgctcctcctcaaggtctcaggtttgattctccccagtgccaatttaggtgg 28787474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 33017212 - 33017306
Alignment:
184 gtaacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||||||||  |  | ||||||||   ||| || ||||||||||||||||||||| ||||||||||||| |  ||||||||||    
33017212 gtaacccacttgggttggccttgtcatattggcttggaacctggaagtgtgctcctcctcaaggtctcaggttcgattctctctggtgccaattt 33017306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 264
Target Start/End: Original strand, 3624582 - 3624658
Alignment:
188 cccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    |||||||||||||||||  |||| |||||||| | ||| |  ||||||||||| ||||||||| |||||||||||||    
3624582 cccacttgggttggcctagtggtattggcttgggacctgggagtgtgctcctcttcaaggtctcaggttcgattctc 3624658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 11979252 - 11979360
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||||||||||  ||  ||||||| |||| | |||||| ||||||| || |||||||||||||||||| |||| ||   ||||||||| |||||     
11979252 aacccacttgggttggtttggcggtgttgacttgggaccttgaagtgtgcttcttctcaaggtcttaggttcggttctgcctgatgccaatttaggtggg 11979351  T
286 ctagtttag 294  Q
    | |||||||    
11979352 ccagtttag 11979360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 18540298 - 18540390
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||||||  |||| |||||||| | ||| |  |||| || ||||||||||||| ||||||||||||| |  ||||||||||    
18540298 aacccacttgggttggcctagtggtattggcttgggacctgggagtgtacttctcctcaaggtctcaggttcgattctctctggtgccaattt 18540390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 22269009 - 22268902
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| ||||||||||||| | |||||  ||||||| || |||||||||| | ||| |||| || || ||||| |||| |||||     
22269009 aacccacttgggttggcctggtggtgttggcttgggaccttggagtgtgct-cttctcaaggtctcaagtttgattttctccggtgcccatttaggtggg 22268911  T
286 ctagtttag 294  Q
     ||||||||    
22268910 ttagtttag 22268902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 230 - 293
Target Start/End: Original strand, 40872920 - 40872983
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagttta 293  Q
    ||||||||||| ||||||| |||||||| |||||| || |||||||||| ||||| ||||||||    
40872920 gtgtgctcctcttcaaggttttaggttccattctctccggtgccaatttaggtgggctagttta 40872983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 230 - 264
Target Start/End: Complemental strand, 22193396 - 22193362
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    |||||||||||||||||||||||||||||||||||    
22193396 gtgtgctcctcctcaaggtcttaggttcgattctc 22193362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 267
Target Start/End: Original strand, 36205198 - 36205276
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccc 267  Q
    ||||||||||||| |||||| | |||| |||||  || |  ||||||||||||||||||||| | ||||||||||||||    
36205198 ccacttgggttggtctgatgttattggtttgagatctgggagtgtgctcctcctcaaggtctcatgttcgattctcccc 36205276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 294
Target Start/End: Complemental strand, 11492146 - 11492041
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggacta 288  Q
    |||||||||||||| ||  ||| ||||||||||  || |  |||||||||| ||| ||||||||||||||||||||  | ||| |||||| ||||| |||    
11492146 ccacttgggttggcatgtcggtattggcttgagatctgggagtgtgctccttctcgaggtcttaggttcgattctcttcagtgtcaatttgggtgggcta 11492047  T
289 gtttag 294  Q
     |||||    
11492046 atttag 11492041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 209 - 290
Target Start/End: Complemental strand, 40137015 - 40136936
Alignment:
209 gtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagt 290  Q
    ||||||||||| | |||||  ||||||||||| ||||||||| ||||| |||||||||  |||||||||||||||| |||||    
40137015 gtgttggcttgggaccttggagtgtgctcctc-tcaaggtctcaggtttgattctcccg-gtgccaatttcggtgggctagt 40136936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 12988428 - 12988520
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||| |||||||  |||| ||||||||   ||| || ||||||||||||||||||| | ||||||||| ||| |  ||||||||||    
12988428 aacccacttggattggcctagtggtattggcttggaacctggaagtgtgctcctcctcaaggtttcaggttcgatcctctctggtgccaattt 12988520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 234 - 294
Target Start/End: Original strand, 28750618 - 28750678
Alignment:
234 gctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    ||||||||| |||||||| ||||||||||||||| ||  |||||| ||||||||| |||||    
28750618 gctcctccttaaggtcttcggttcgattctccccggtatcaatttgggtggactaatttag 28750678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 245 - 292
Target Start/End: Complemental strand, 35475593 - 35475546
Alignment:
245 aggtcttaggttcgattctcccctgtgccaatttcggtggactagttt 292  Q
    |||||| |||||||||| ||||| |||||||||||||||| |||||||    
35475593 aggtctcaggttcgattatccccggtgccaatttcggtgggctagttt 35475546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 230 - 284
Target Start/End: Original strand, 6536564 - 6536618
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||||||||||||| |||||| |||||| |  |||||||||| |||||    
6536564 gtgtgctcctcctcaaggtctcaggttcaattctctctggtgccaatttaggtgg 6536618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 8484999 - 8485107
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtcct-tgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||||||||| |||| || ||||| | ||| ||| ||||||||||| |  |||||| |  |||||||||| || |||||||||| |||||    
8484999 aacccacttgggttggcctggtggtatttgcttgggacctgtga-gtgtgctcctctttgaggtctcattttcgattctctccggtgccaatttaggtgg 8485097  T
285 actagtttag 294  Q
     ||| |||||    
8485098 gctaatttag 8485107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 263
Target Start/End: Original strand, 29206345 - 29206421
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattct 263  Q
    |||||||| ||||||||||| |||||| ||||||   |||||  |||||||||| |||||||| | ||||||||||||    
29206345 aacccactagggttggcctggtggtgtgggcttggtaccttggggtgtgctcct-ctcaaggtgtcaggttcgattct 29206421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 262
Target Start/End: Complemental strand, 33727950 - 33727873
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattc 262  Q
    ||||||| |||||||| |||  |||| | || ||||| | | || ||||||||||||||||||||| |||||||||||    
33727950 taacccatttgggttgccctagtggtataggtttgagacttggaagtgtgctcctcctcaaggtctcaggttcgattc 33727873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 233 - 278
Target Start/End: Original strand, 40888848 - 40888893
Alignment:
233 tgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||| ||| |||| ||||||| ||||||||||||    
40888848 tgctcctcctcaaggttttatgttcaattctcctctgtgccaattt 40888893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 57; Significance: 2e-23; HSPs: 18)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 24334101 - 24333993
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||| ||||||||||||||| | | |||  || |||||||||||||||||| |||||| |||||| || |||||||||| |||||     
24334101 aacccacttgggttggccggatggtgttggcttgggacattgcagtatgctcctcctcaaggtctcaggttcaattctcaccggtgccaatttgggtggg 24334002  T
286 ctagtttag 294  Q
    |||||||||    
24334001 ctagtttag 24333993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 193 - 291
Target Start/End: Complemental strand, 24762476 - 24762379
Alignment:
193 ttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtt 291  Q
    ||||||||| || |||||||||||||| | ||||| |||||||||||| | ||||||||||||||||| |||||| |||||||||| ||||| ||||||    
24762476 ttgggttggtctaatggtgttggcttgggaccttggtgtgtgctcctctt-aaggtcttaggttcgatcctccccggtgccaattttggtgggctagtt 24762379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 191 - 282
Target Start/End: Complemental strand, 6691621 - 6691531
Alignment:
191 acttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggt 282  Q
    ||||||||||||||| |||||||| ||| || |||||  ||||||||||| ||||||||| ||||||||||||| || ||||||||||||||    
6691621 acttgggttggcctggtggtgttgactttagaccttggagtgtgctcctc-tcaaggtctcaggttcgattctctccggtgccaatttcggt 6691531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 186 - 266
Target Start/End: Original strand, 14557962 - 14558042
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctccc 266  Q
    |||||||||||||||| ||| ||||||||||||| | ||| || ||||||||||||||  ||||| |||||||||||||||    
14557962 aacccacttgggttggtctggtggtgttggcttgggacctggaagtgtgctcctcctccgggtctcaggttcgattctccc 14558042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 190 - 276
Target Start/End: Original strand, 3869700 - 3869785
Alignment:
190 cacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaat 276  Q
    ||||||||||||||||||||||||||||||||  |||   ||||||| ||  ||||||||| | |||||||||||||| ||||||||    
3869700 cacttgggttggcctgatggtgttggcttgagatcttcgagtgtgcttct-atcaaggtctcatgttcgattctccccggtgccaat 3869785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 33549104 - 33549182
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    |||||||||||||||| ||| |||| |||||||| | ||| |  |||||||||||||| |||||| |||||||||||||    
33549104 aacccacttgggttggtctggtggtattggcttgggacctgggagtgtgctcctcctcgaggtctcaggttcgattctc 33549182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 190 - 267
Target Start/End: Complemental strand, 10338246 - 10338169
Alignment:
190 cacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccc 267  Q
    ||||||||||||| || |||| |||||||| | ||| |  ||||||||||||||||||||| ||||||||||| ||||    
10338246 cacttgggttggcatggtggtattggcttgggacctaggagtgtgctcctcctcaaggtctcaggttcgattcccccc 10338169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 278
Target Start/End: Complemental strand, 12188379 - 12188287
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||||||  |||| |||||||| | ||| |  ||||||||||||||||||| | | ||||||||||| |  ||||||||||    
12188379 aacccacttgggttggcctagtggtattggcttgggacctgggagtgtgctcctcctcaaggtttcaagttcgattctctctagtgccaattt 12188287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 23241987 - 23242094
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||||||||||| || || ||||| |||| | ||| |  |||| |||||||||||||||  |||| || |||||||| |||||||||| |||||     
23241987 aacccacttgggttggc-tggtgatgttgccttgggacctcggagtgtactcctcctcaaggtcacaggtccggttctccccggtgccaatttgggtggg 23242085  T
286 ctagtttag 294  Q
    |||||||||    
23242086 ctagtttag 23242094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 188 - 291
Target Start/End: Original strand, 33560381 - 33560484
Alignment:
188 cccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggact 287  Q
    ||||||| ||||| |||  ||||||||||||||| |||||  ||||| ||||||| || |||| | ||||||||||||   |||||||||| |||||| |    
33560381 cccactttggttgtcctagtggtgttggcttgagaccttggagtgtgatcctccttaaagtctcatgttcgattctccttggtgccaatttgggtggatt 33560480  T
288 agtt 291  Q
    ||||    
33560481 agtt 33560484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 280
Target Start/End: Original strand, 28028530 - 28028623
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcg 280  Q
    |||||||||||||||||||| |||||||| |||| | ||||   ||| |||||| |||||||||| | |||||||||||||   |||||||||||    
28028530 aacccacttgggttggcctggtggtgttgacttgggacctttgagtgagctcct-ctcaaggtctcatgttcgattctccctgatgccaatttcg 28028623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 192 - 266
Target Start/End: Original strand, 34444809 - 34444883
Alignment:
192 cttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctccc 266  Q
    |||||||||||||| |||| ||| |||| | ||||   |||||||||||| |||||||| |||||||||||||||    
34444809 cttgggttggcctggtggtattgacttgggaccttagagtgtgctcctccccaaggtctcaggttcgattctccc 34444883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 290
Target Start/End: Complemental strand, 7484320 - 7484232
Alignment:
201 gcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagt 290  Q
    ||||| |||| |||||||||| |||||| | ||||||| | ||||||||| | ||| ||||| |||| |||||||||||||||| |||||    
7484320 gcctggtggtattggcttgagaccttgaagagtgctccgc-tcaaggtctcacgttagattccccccggtgccaatttcggtgggctagt 7484232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 278
Target Start/End: Original strand, 30127399 - 30127492
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||| ||| |||| |||||||| |  || |  ||||||||||| || |||||| ||||||||||||  || ||||||||||    
30127399 taacccacttgggttggtctggtggtattggcttggggtctgggagtgtgctcctcttcgaggtctcaggttcgattctttccggtgccaattt 30127492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 21418470 - 21418578
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||| ||||||||||||| |||| |||||||| | | | |  |||||||||||||| | |||| | |||||||||||||  |||||||||  |||||     
21418470 aacccagttgggttggcctggtggtattggcttgggacttgggagtgtgctcctcctccatgtctcaagttcgattctccctagtgccaattaaggtggg 21418569  T
286 ctagtttag 294  Q
    ||| |||||    
21418570 ctaatttag 21418578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 193 - 293
Target Start/End: Complemental strand, 24507605 - 24507505
Alignment:
193 ttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagttt 292  Q
    ||||||||||||  ||||||||||||| | |||||  || ||||||||||||||||||  ||||| |||||| || ||  |||||| |||||  ||||||    
24507605 ttgggttggcctagtggtgttggcttgggaccttggagtttgctcctcctcaaggtctagggttcaattctctccggtatcaatttaggtgggttagttt 24507506  T
293 a 293  Q
    |    
24507505 a 24507505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 293
Target Start/End: Original strand, 2616476 - 2616583
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||| ||||||||||||  |||| || ||||||||| | || ||||||||||| ||||||||| | ||||| ||||| ||  || |||||| | ||||    
2616476 aacccatttgggttggcctagtggtattagcttgagtcatggaagtgtgctcctcttcaaggtctcaagttcgtttctctccaatgtcaatttagatgga 2616575  T
286 ctagttta 293  Q
    ||| ||||    
2616576 ctaattta 2616583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 231 - 294
Target Start/End: Original strand, 6385907 - 6385970
Alignment:
231 tgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    |||||||||||| ||||||| ||||||||||||| || |||| ||||| ||||| ||| |||||    
6385907 tgtgctcctccttaaggtctcaggttcgattctctccggtgctaatttgggtgggctaatttag 6385970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 53; Significance: 5e-21; HSPs: 22)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 16457810 - 16457918
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||| |||||||||| |||| |||||||| | |||||  ||||||||||||||||||||| | |||| ||||||||| ||||||||||  ||||     
16457810 aacccacttaggttggcctggtggtattggcttgggaccttggagtgtgctcctcctcaaggtctcatgttcaattctccccggtgccaatttgcgtggg 16457909  T
286 ctagtttag 294  Q
    |||||||||    
16457910 ctagtttag 16457918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 185 - 273
Target Start/End: Complemental strand, 31669101 - 31669014
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgcc 273  Q
    ||||||||||||||||| ||||||||||||||||| | |||||  || ||||||| ||||||||||||||||||||||||||| |||||    
31669101 taacccacttgggttggtctgatggtgttggcttgggaccttggagtctgctcct-ctcaaggtcttaggttcgattctccccggtgcc 31669014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 189 - 265
Target Start/End: Complemental strand, 16173056 - 16172981
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcc 265  Q
    ||||||||||||||||| | ||||||||||||| |||||  |||||||||| |||||||||| ||||||||||||||    
16173056 ccacttgggttggcctggtagtgttggcttgagaccttggagtgtgctcct-ctcaaggtctcaggttcgattctcc 16172981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 263
Target Start/End: Original strand, 19373239 - 19373315
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattct 263  Q
    |||||||||| ||||||||| ||||||||||||||| |||||  ||||||| || |||||||| ||||||||||||||    
19373239 aacccacttgagttggcctggtggtgttggcttgagaccttggagtgtgctact-ctcaaggttttaggttcgattct 19373315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 34984806 - 34984898
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||| ||  |||| ||||||||   ||| |  ||||||||||||||||||||||||||||||||||| |  ||||||||||    
34984806 aacccacttgggttggtctagtggtattggcttggaacctgggagtgtgctcctcctcaaggtcttaggttcgattctctctggtgccaattt 34984898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 207 - 278
Target Start/End: Original strand, 3315236 - 3315307
Alignment:
207 tggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||| ||||||| |||||  ||| ||||||||||||||||| |||||||||||||||  ||||||||||    
3315236 tggtgttagcttgagaccttggagtgcgctcctcctcaaggtctcaggttcgattctcccaggtgccaattt 3315307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 185 - 278
Target Start/End: Complemental strand, 7918546 - 7918453
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||||||  |||| ||||||||   ||| |  |||  |||||||||||||||||||||||||||||| |  ||||||||||    
7918546 taacccacttgggttggcctagtggtattggcttggaacctgggagtgcactcctcctcaaggtcttaggttcgattctctctggtgccaattt 7918453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 21589288 - 21589396
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| |||| |||||||| | ||| |  || |||| |||||| | |||| ||||||||||| | |  |||||||||| |||||     
21589288 aacccacttgggttggcctggtggtattggcttgggacctgggagtctgctactcctcgatgtctcaggttcgattccctctggtgccaatttaggtggg 21589387  T
286 ctagtttag 294  Q
    |||||||||    
21589388 ctagtttag 21589396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 30109384 - 30109277
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||||||||||| || |||| |||||||| | ||| |  |||||||||||||  |||||| ||||||||||| |||| |||| ||||| |||||     
30109384 aacccacttgggttggcttggtggtattggcttgtgacctgggagtgtgctcctccttgaggtctcaggttcgattc-ccccggtgctaatttaggtggg 30109286  T
286 ctagtttag 294  Q
    ||| |||||    
30109285 ctaatttag 30109277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 185 - 264
Target Start/End: Original strand, 25627056 - 25627135
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    ||||||||||||||||||||  |||| ||||||||   | | |  ||||||||||||||||||||| |||||||||||||    
25627056 taacccacttgggttggcctagtggtattggcttggaacttgggagtgtgctcctcctcaaggtctcaggttcgattctc 25627135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 255
Target Start/End: Complemental strand, 18989078 - 18989008
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggt 255  Q
    ||||||||||||||| || |||||||||||||||| | |||||  ||||||||||| ||||| | ||||||    
18989078 taacccacttgggtttgcatgatggtgttggcttgggaccttggagtgtgctcctcttcaagattttaggt 18989008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 284
Target Start/End: Complemental strand, 30883274 - 30883176
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||||| ||  |||| |||||||| | ||| |  ||||||||||||||||||||| | |||| |||||| || ||| |||||| |||||    
30883274 aacccacttgggttggtctagtggtattggcttgggacctgggagtgtgctcctcctcaaggtctcaagttcaattctcaccagtgtcaatttgggtgg 30883176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 230 - 274
Target Start/End: Original strand, 84868 - 84912
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgcca 274  Q
    ||||||||||||||||||||| | |||||||||||||| ||||||    
84868 gtgtgctcctcctcaaggtctcaagttcgattctccccggtgcca 84912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 230 - 278
Target Start/End: Original strand, 14285205 - 14285253
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||||||| ||||||||||||| |  ||||||||||    
14285205 gtgtgctcctcctcaaggtctcaggttcgattctctctggtgccaattt 14285253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 16773807 - 16773915
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||| ||||| ||| |||| ||| |||| | ||| |  |||||||||||||| |||||| ||||||||||||| |   ||||||||| |||||     
16773807 aacccacttgagttggtctggtggtattgacttgggacctgggagtgtgctcctcctcgaggtctcaggttcgattctctctgatgccaatttaggtggg 16773906  T
286 ctagtttag 294  Q
    ||| |||||    
16773907 ctaatttag 16773915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 231 - 278
Target Start/End: Complemental strand, 18596032 - 18595985
Alignment:
231 tgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||||||||||||||||| || |  ||||||||||    
18596032 tgtgctcctcctcaaggtcttaggttcgattttctctggtgccaattt 18595985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 231 - 278
Target Start/End: Original strand, 18974005 - 18974052
Alignment:
231 tgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||||| | |||||||||||||||  ||||||||||    
18974005 tgtgctcctcctcaaggtgtcaggttcgattctccctggtgccaattt 18974052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 230 - 264
Target Start/End: Complemental strand, 39327122 - 39327088
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    |||||||||||||||||||||||| ||||||||||    
39327122 gtgtgctcctcctcaaggtcttagcttcgattctc 39327088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 230 - 264
Target Start/End: Original strand, 43442240 - 43442274
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    ||||||||||||||||||||| |||||||||||||    
43442240 gtgtgctcctcctcaaggtctcaggttcgattctc 43442274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 294
Target Start/End: Complemental strand, 8278352 - 8278243
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||||||||| |||||||| |||||||| | | | |  |||||||||||||| || ||| | ||| |||| || || ||||| |||| |||||    
8278352 taacccacttgggttggtctgatggtattggcttgggacttgggagtgtgctcctcctcgagatctcaagtttgattatctccggtgccgatttaggtgg 8278253  T
285 actagtttag 294  Q
     ||| |||||    
8278252 gctaatttag 8278243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 261
Target Start/End: Complemental strand, 14656717 - 14656645
Alignment:
188 cccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgatt 261  Q
    |||||| |||||| |||| | ||||||||||||| |||||  || ||||||| |||||||||| ||||||||||    
14656717 cccactagggttgacctggttgtgttggcttgagaccttggagtttgctcct-ctcaaggtctcaggttcgatt 14656645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 230 - 283
Target Start/End: Complemental strand, 35360118 - 35360065
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtg 283  Q
    ||||||| |||||| |||||| ||||||||||||| || |||||||||| ||||    
35360118 gtgtgcttctcctcgaggtctcaggttcgattctcaccggtgccaatttaggtg 35360065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 53; Significance: 5e-21; HSPs: 48)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 186 - 290
Target Start/End: Original strand, 34844371 - 34844474
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||||||||| |||| || |||||||||||| |||||  |||||||||| |||||||||| ||||||||||| | || | |||||||||||||||    
34844371 aacccacttgggttgccctggtgttgttggcttgagaccttggagtgtgctcct-ctcaaggtctcaggttcgattccctccagagccaatttcggtgga 34844469  T
286 ctagt 290  Q
    |||||    
34844470 ctagt 34844474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 40268489 - 40268596
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||| ||||| ||||||||||||| | |||||  ||| ||||||| | ||||||| ||||||||||||||||  |||||||||||||||     
40268489 aacccacttgggtttgcctggtggtgttggcttgggaccttggagtgggctcctctt-aaggtctcaggttcgattctccccgatgccaatttcggtggg 40268587  T
286 ctagtttag 294  Q
     ||||||||    
40268588 ttagtttag 40268596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 12925471 - 12925402
Alignment:
1 tgctgtgggaaagcttgacaggtagagagcacctacttttttatggcagactgaaaaatcttaaaggttc 70  Q
    |||||||||||| ||||||||| |||||||| ||||| ||||| |||||||| |||||||||||||||||    
12925471 tgctgtgggaaatcttgacaggaagagagcatctactcttttacggcagacttaaaaatcttaaaggttc 12925402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 184 - 284
Target Start/End: Original strand, 14186646 - 14186745
Alignment:
184 gtaacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtg 283  Q
    |||||||||||||||||||||  |||| ||| |||| | ||| || ||||||||||||||||||||| ||||||||||||| || ||| |||||| ||||    
14186646 gtaacccacttgggttggcctagtggtattgtcttgggacctgga-gtgtgctcctcctcaaggtctcaggttcgattctctccggtgtcaatttaggtg 14186744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 27923119 - 27923011
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||| |||||||||| |||| |||||||| | | | || |||||||||||||||  |||| ||||||||||| | |||||| |||||| ||||||    
27923119 aacccacttaggttggcctggtggtattggcttgggacatggaagtgtgctcctcctcatagtctcaggttcgattcccacctgtgtcaatttgggtgga 27923020  T
286 ctagtttag 294  Q
    ||| |||||    
27923019 ctaatttag 27923011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 186 - 293
Target Start/End: Complemental strand, 26871580 - 26871473
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| ||||||||||||| | |||||  || | ||||||||||| |||| ||||| |||||| |||  ||||||||| |||||     
26871580 aacccacttgggttggcctggtggtgttggcttgggaccttggagttttctcctcctcaaagtctgaggtttgattctacccaatgccaatttgggtggg 26871481  T
286 ctagttta 293  Q
    ||| ||||    
26871480 ctaattta 26871473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 207 - 294
Target Start/End: Original strand, 44069779 - 44069866
Alignment:
207 tggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    |||||||||||||||  ||||  ||||||||||||||||||||| ||||| ||||||  || |||||||||| ||||| |||||||||    
44069779 tggtgttggcttgagatcttggagtgtgctcctcctcaaggtctcaggtttgattctttccggtgccaatttaggtgggctagtttag 44069866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 187 - 294
Target Start/End: Complemental strand, 47454692 - 47454585
Alignment:
187 acccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggac 286  Q
    ||||||||||||||  ||  |||| ||||||||||  ||||  |||||||||||||| |||||| ||||||||||||||||  ||||||||| |||||      
47454692 acccacttgggttgttctagtggtattggcttgagatcttggagtgtgctcctcctcgaggtctcaggttcgattctccccaatgccaatttaggtgggt 47454593  T
287 tagtttag 294  Q
    ||||||||    
47454592 tagtttag 47454585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 294
Target Start/End: Complemental strand, 13164836 - 13164729
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||| | ||| |||| ||||||||||||  | |||||  ||||||| |||||||||||||||||||| ||||||||  ||||||||||  || |    
13164836 taacccactttgattgacctggtggtgttggctttggaccttggagtgtgctactcctcaaggtcttaggttcaattctccc--gtgccaattttcgtag 13164739  T
285 actagtttag 294  Q
    ||||||||||    
13164738 actagtttag 13164729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 187 - 265
Target Start/End: Complemental strand, 18316573 - 18316496
Alignment:
187 acccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcc 265  Q
    ||||||||||||||| ||| ||||| ||||||| | |||||  |||||||||| |||||||||||||||||||||||||    
18316573 acccacttgggttggtctggtggtgctggcttgggaccttggagtgtgctcct-ctcaaggtcttaggttcgattctcc 18316496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 188 - 294
Target Start/End: Original strand, 19716199 - 19716305
Alignment:
188 cccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggact 287  Q
    |||| |||||||| | || ||||||||||||| | || ||  |||||||||||||||||||||  ||||||||||||||| ||| |||||| ||||| ||    
19716199 cccatttgggttgacatggtggtgttggcttgggaccatggagtgtgctcctcctcaaggtctctggttcgattctccccggtgacaatttgggtgggct 19716298  T
288 agtttag 294  Q
    | |||||    
19716299 aatttag 19716305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 186 - 292
Target Start/End: Original strand, 43303758 - 43303863
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||| ||||||||||||| ||||| ||||||||| |||||  | |||||||| ||| |||||| ||||| |||||||||| |||| ||| |||||||     
43303758 aacccatttgggttggcctggtggtgatggcttgagaccttggagcgtgctcct-ctccaggtctcaggtttgattctccccggtgctaatatcggtggg 43303856  T
286 ctagttt 292  Q
    |||||||    
43303857 ctagttt 43303863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 186 - 280
Target Start/End: Complemental strand, 53863943 - 53863850
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcg 280  Q
    ||||||||||||||| |||| || |||||||||| | |||||  |||||||||| ||||||||||||||||| |||||| |  ||||||||||||    
53863943 aacccacttgggttgtcctggtgatgttggcttgggaccttggagtgtgctcct-ctcaaggtcttaggttcaattctctctggtgccaatttcg 53863850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 279
Target Start/End: Complemental strand, 5499483 - 5499390
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttc 279  Q
    |||||||||||||||||||| |||| ||| ||||||  ||    ||||||||||||| ||||||| |||||| ||||||||| |||||||||||    
5499483 aacccacttgggttggcctggtggtattgacttgagatctgagagtgtgctcctccttaaggtctaaggttctattctccccggtgccaatttc 5499390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 188 - 265
Target Start/End: Complemental strand, 42799821 - 42799745
Alignment:
188 cccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcc 265  Q
    |||||||||||||||||| ||||||||||||| | |||||  |||||||||| |||||||||| |||||||| |||||    
42799821 cccacttgggttggcctggtggtgttggcttgggaccttggagtgtgctcct-ctcaaggtctcaggttcgactctcc 42799745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 284
Target Start/End: Complemental strand, 11092245 - 11092148
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||||||||  ||||||||||||| | |||||  ||||||| || |||||||||| |  ||||||||||||  |||| |||||||||||    
11092245 aacccacttgggttggcctagtggtgttggcttgggaccttgtagtgtgctact-ctcaaggtctcaacttcgattctccctggtgctaatttcggtgg 11092148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 267
Target Start/End: Complemental strand, 14270601 - 14270522
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccc 267  Q
    |||||| ||||||||||||||||||||||| ||||| | |||  | |||||||||| |||| ||||||||| ||||||||||    
14270601 aacccaattgggttggcctgatggtgttggtttgagacgttg--gagtgctcctccccaagatcttaggtttgattctcccc 14270522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 283
Target Start/End: Original strand, 15034348 - 15034441
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtg 283  Q
    ||||||||||||||||| |||||||| |||| | |||||  | ||| ||||| ||||||||| |||||| ||||||||  |||||||||||||||    
15034348 ccacttgggttggcctggtggtgttgccttgggaccttggagggtgatcctc-tcaaggtctcaggttcaattctccctggtgccaatttcggtg 15034441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 257
Target Start/End: Original strand, 3054993 - 3055065
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttc 257  Q
    ||||||||||||||||||||| ||||||||||||| | |||||  | ||||| ||||||||| ||| ||||||    
3054993 taacccacttgggttggcctggtggtgttggcttgggaccttggagcgtgcttctcctcaagatctcaggttc 3055065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 230 - 294
Target Start/End: Original strand, 11612343 - 11612407
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    ||||||||||||| ||||||| ||||||||| |||||| |||||||||| ||| ||||| |||||    
11612343 gtgtgctcctccttaaggtctcaggttcgatgctccccggtgccaatttaggtcgactaatttag 11612407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 278
Target Start/End: Complemental strand, 31520681 - 31520589
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||||||| |||  |||||||| |  || |  |||||||||||||| |||||||||||| ||||||| || ||| ||||||    
31520681 aacccacttgggttggcctggtggcattggcttgggatctgggagtgtgctcctcctcgaggtcttaggtttgattctctccagtgtcaattt 31520589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 185 - 292
Target Start/End: Original strand, 42430334 - 42430438
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||||||| || |||| ||| |||| |  ||||  ||||||||||| |||||||||||| |||||||||||||  |||||||||||| ||    
42430334 taacccacttgggttggc-tggtggtattgacttgggatcttggagtgtgctcctc-tcaaggtcttag-ttcgattctccccaatgccaatttcggggg 42430430  T
285 actagttt 292  Q
     |||||||    
42430431 gctagttt 42430438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 185 - 284
Target Start/End: Complemental strand, 47810821 - 47810722
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||||||||| ||| |||| |||||||  ||| | |  |||||||||||| ||||||||  |||| ||||||| || |||||||||| |||||    
47810821 taacccacttgggttggtctggtggtattggctttggtcttgggagtgtgctcctccgcaaggtctcgggtttgattctctccggtgccaatttgggtgg 47810722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 4222141 - 4222219
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    ||||||||||||||||| |  |||| |||||||| |  || |  |||||||||||||||| ||||||||||||||||||    
4222141 aacccacttgggttggcttagtggtattggcttgggatctgggagtgtgctcctcctcaaagtcttaggttcgattctc 4222219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 279
Target Start/End: Original strand, 7207609 - 7207702
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttc 279  Q
    |||||||||||||||||| || |||||||| |||| | |||||| | ||| |||| || ||||| | |||||||||||||| | |||||||||||    
7207609 taacccacttgggttggcttggtggtgttgccttgggaccttgaagggtgatcct-cttaaggtttcaggttcgattctcctcagtgccaatttc 7207702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 294
Target Start/End: Original strand, 40777012 - 40777120
Alignment:
184 gtaacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtg 283  Q
    |||||||||||||||||  ||| |||||||| | || | | |||  ||||||||||| ||||||||| ||||| ||||||| |  |||||||||||||||    
40777012 gtaacccacttgggttgatctggtggtgttg-catgggacattggagtgtgctcctc-tcaaggtctcaggtttgattctctctagtgccaatttcggtg 40777109  T
284 gactagtttag 294  Q
    | |||||||||    
40777110 ggctagtttag 40777120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 230 - 284
Target Start/End: Complemental strand, 47237003 - 47236949
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||||||| ||||||||| | |||||||||||||| |||||||||| |||||    
47237003 gtgtgctcctcttcaaggtctcatgttcgattctccccggtgccaatttgggtgg 47236949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 202 - 294
Target Start/End: Complemental strand, 13347961 - 13347872
Alignment:
202 cctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    |||| ||||||||||||  | |||||  ||||||| |||||||| ||||||||||||| ||||||  |||||||||| ||| |||||||||||    
13347961 cctggtggtgttggctttggaccttggagtgtgctactcctcaaagtcttaggttcga-tctccc--gtgccaattttggtagactagtttag 13347872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 294
Target Start/End: Original strand, 14339609 - 14339718
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    ||||||| |||| |||||||| |||| |||||||| |   | |  |||||||||||||||| |||| |||||||||||||||  |||||||||  |||||    
14339609 taacccagttggattggcctggtggtattggcttgggatttgggagtgtgctcctcctcaatgtctcaggttcgattctccctagtgccaattaaggtgg 14339708  T
285 actagtttag 294  Q
     ||| |||||    
14339709 gctaatttag 14339718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 193 - 265
Target Start/End: Original strand, 5166435 - 5166507
Alignment:
193 ttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcc 265  Q
    |||||| |||| ||||||||||  ||||| |||||  ||||||| ||||||||| ||| ||||||||||||||    
5166435 ttgggtaggcccgatggtgttgatttgagaccttggagtgtgctgctcctcaagatctcaggttcgattctcc 5166507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 8051214 - 8051306
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||||||| |||| |||||||| | ||| |  || |||| |||||| |||||| | ||||||||| | || ||||||||||    
8051214 aacccacttgggttggcctggtggtattggcttgggacctggcagtatgcttctcctcgaggtctcaagttcgattccctccggtgccaattt 8051306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 230 - 266
Target Start/End: Complemental strand, 9345292 - 9345256
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctccc 266  Q
    ||||||||||||| |||||||||||||||||||||||    
9345292 gtgtgctcctcctaaaggtcttaggttcgattctccc 9345256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 230 - 278
Target Start/End: Original strand, 20501740 - 20501788
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||| ||||||| ||||||||||||| || ||||||||||    
20501740 gtgtgctcctccttaaggtctcaggttcgattctctccagtgccaattt 20501788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 30232330 - 30232422
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||| |||| |||| |||| ||| |  || ||  |||||||||||||| ||||| |||||| |||||| || ||||||||||    
30232330 aacccacttgggttgccctggtggtattggtttgcgatctggaactgtgctcctcctcatggtctcaggttccattctctccggtgccaattt 30232422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 230 - 278
Target Start/End: Complemental strand, 37788497 - 37788449
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||||||| ||||||||||||| |  ||||||||||    
37788497 gtgtgctcctcctcaaggtctcaggttcgattctctctagtgccaattt 37788449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 184 - 252
Target Start/End: Complemental strand, 40286935 - 40286867
Alignment:
184 gtaacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtctta 252  Q
    |||||||||||||||||| ||| ||||||| |||||||  ||||  ||||| ||||||||||| |||||    
40286935 gtaacccacttgggttggtctggtggtgttcgcttgagatcttggagtgtggtcctcctcaagatctta 40286867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 210 - 294
Target Start/End: Original strand, 54990726 - 54990810
Alignment:
210 tgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagtttag 294  Q
    |||||||||| | |||||  | ||||||||||||||||||| |||||||||||||| |  || |||||| ||||| ||| |||||    
54990726 tgttggcttgggaccttggagcgtgctcctcctcaaggtctcaggttcgattctcctcgatggcaatttaggtgggctaatttag 54990810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 236 - 282
Target Start/End: Complemental strand, 13174987 - 13174941
Alignment:
236 tcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggt 282  Q
    ||||||||||||||  ||||||||||||||||  |||||||||||||    
13174987 tcctcctcaaggtccgaggttcgattctccccgatgccaatttcggt 13174941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 19154631 - 19154709
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    |||||| ||||||||||||  | || |||||||||| |||    ||||||||||||| ||||||| |||||||||||||    
19154631 aacccatttgggttggcctagttgtattggcttgaggcctgagagtgtgctcctcctaaaggtctcaggttcgattctc 19154709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 230 - 264
Target Start/End: Original strand, 30311350 - 30311384
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    ||||||||||||||||||||| |||||||||||||    
30311350 gtgtgctcctcctcaaggtctcaggttcgattctc 30311384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 230 - 284
Target Start/End: Complemental strand, 44743887 - 44743833
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||||||| |||||| |||||||||| || || |||||||||| |||||    
44743887 gtgtgctcctcctcgaggtctcaggttcgattatctccagtgccaatttgggtgg 44743833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 51903956 - 51903862
Alignment:
184 gtaacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||| ||||||| |||| |||| |||||||| |  || |  ||||||||||||||  ||||| ||||||||||||| || ||| ||||||    
51903956 gtaacccacctgggttgacctgttggtattggcttgggatctgggagtgtgctcctcctcgtggtctcaggttcgattctctccggtgtcaattt 51903862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 264
Target Start/End: Complemental strand, 353228 - 353155
Alignment:
191 acttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    ||||||||||||||| ||| ||||||| | | |||||  || | || ||||||||||||| |||||||||||||    
353228 acttgggttggcctggtggcgttggctagggaccttgtagtattcttctcctcaaggtctcaggttcgattctc 353155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 294
Target Start/End: Original strand, 2667869 - 2667970
Alignment:
193 ttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagttt 292  Q
    ||||||||||||| |||| |||||||| |  || |  |||||||| ||||| |||||| |||||||||| || |  ||| |||||| ||||| |||||||    
2667869 ttgggttggcctggtggtattggcttgggatctgggagtgtgctcttcctcgaggtctcaggttcgattatctctagtgtcaatttaggtgggctagttt 2667968  T
293 ag 294  Q
    ||    
2667969 ag 2667970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 232 - 293
Target Start/End: Original strand, 17035032 - 17035093
Alignment:
232 gtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagttta 293  Q
    |||||| |||||||||||| |||||||||||||| | ||  |||||| ||||||||| ||||    
17035032 gtgctcatcctcaaggtctcaggttcgattctcctcggtatcaatttgggtggactaattta 17035093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 262
Target Start/End: Complemental strand, 35623345 - 35623267
Alignment:
186 aacccacttgggttggcctg---atggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattc 262  Q
    ||||||||||||||||||||    ||||||||||||| | |||||  |||||||||| |||||||||| | |||||||||    
35623345 aacccacttgggttggcctggttgtggtgttggcttgggaccttggagtgtgctcct-ctcaaggtctcatgttcgattc 35623267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 283
Target Start/End: Complemental strand, 35981762 - 35981665
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtg 283  Q
    |||| ||||||||||   || ||||||||| ||| | | ||| | |||||||||||| |||||||||||||| ||||||| | ||| |||||| ||||    
35981762 aacctacttgggttgttttggtggtgttggtttgggactttggtatgtgctcctccttaaggtcttaggttcaattctcctccgtgtcaatttaggtg 35981665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 278
Target Start/End: Original strand, 53412948 - 53413037
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||| ||  |||| ||||||||   ||| |  ||||||||||||||||||||| |||||| |||||| |  ||||||||||    
53412948 ccacttgggttggtctagtggtattggcttgtaacctgggagtgtgctcctcctcaaggtctcaggttcaattctctctggtgccaattt 53413037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0221 (Bit Score: 49; Significance: 1e-18; HSPs: 1)
Name: scaffold0221
Description:

Target: scaffold0221; HSP #1
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 2985 - 2877
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    ||||||||||||||||| || |||| |||| ||| | |||||| ||||| ||||||| ||||||| | |||||||||||| || ||||||||| |||| |    
2985 aacccacttgggttggcttggtggttttggtttgggaccttgaagtgtgatcctccttaaggtctcaagttcgattctccactatgccaatttgggtgaa 2886  T
286 ctagtttag 294  Q
    |||||||||    
2885 ctagtttag 2877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0517 (Bit Score: 45; Significance: 3e-16; HSPs: 1)
Name: scaffold0517
Description:

Target: scaffold0517; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 7802 - 7694
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||| ||||||||||| ||| |||| |||||||||| |||  | ||||||||||||| ||||||| | ||||||||||  || |||||||||| | ||||    
7802 aaccaacttgggttggtctggtggtattggcttgagacctgaaagtgtgctcctccttaaggtctcaagttcgattctatccggtgccaatttggatgga 7703  T
286 ctagtttag 294  Q
    |||||||||    
7702 ctagtttag 7694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 3)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 294
Target Start/End: Original strand, 142152 - 142259
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgg 284  Q
    |||||||||| | ||| |||| ||||||||||||  | |||||  ||||||| |||||||||||||||||||| ||||||||  ||||||||||  || |    
142152 taacccactttgattgacctggtggtgttggctttggaccttggagtgtgctactcctcaaggtcttaggttcaattctccc--gtgccaattttcgtag 142249  T
285 actagtttag 294  Q
    ||||||||||    
142250 actagtttag 142259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 236 - 282
Target Start/End: Original strand, 132001 - 132047
Alignment:
236 tcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggt 282  Q
    ||||||||||||||  ||||||||||||||||  |||||||||||||    
132001 tcctcctcaaggtccgaggttcgattctccccgatgccaatttcggt 132047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #3
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 95044 - 94955
Alignment:
189 ccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    ||||||||||||||||  |||| ||||||||   ||| |  ||||||||||||||||||||| |||||| ||| || |  ||||||||||    
95044 ccacttgggttggcctagtggtattggcttggaacctgggagtgtgctcctcctcaaggtctcaggttcaattatctctggtgccaattt 94955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0258 (Bit Score: 41; Significance: 0.00000000000007; HSPs: 1)
Name: scaffold0258
Description:

Target: scaffold0258; HSP #1
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 15399 - 15291
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||| ||| |||| |||||||| | ||| |  |||||||||||||| |||||| ||||||||||||| |   ||||||||| |||||     
15399 aacccacttgggttggtctggtggtattggcttgggacctgggagtgtgctcctcctcgaggtctcaggttcgattctctcggatgccaatttaggtggg 15300  T
286 ctagtttag 294  Q
    ||| |||||    
15299 ctaatttag 15291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0236 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0236
Description:

Target: scaffold0236; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 191 - 293
Target Start/End: Complemental strand, 24911 - 24809
Alignment:
191 acttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagt 290  Q
    ||||||||||||||| |||||||| |||| | |||||  || |||||||||||||||||| || ||||||| ||||  | |||||||| | ||| |||||    
24911 acttgggttggcctggtggtgttgacttggggccttggagtttgctcctcctcaaggtctcagattcgattgtccctggagccaatttggatggcctagt 24812  T
291 tta 293  Q
    |||    
24811 tta 24809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0189 (Bit Score: 36; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0189
Description:

Target: scaffold0189; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 191 - 294
Target Start/End: Complemental strand, 17794 - 17692
Alignment:
191 acttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagt 290  Q
    ||||||||||||||| |||| ||||| | || |||||  |||| |||||| ||||||||| |||||||||||||| |   ||||||||| |||| |||||    
17794 acttgggttggcctggtggtattggcgtaagaccttggagtgttctcctc-tcaaggtctcaggttcgattctcctcgaggccaatttcagtgggctagt 17696  T
291 ttag 294  Q
    ||||    
17695 ttag 17692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0194 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0194
Description:

Target: scaffold0194; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 190 - 264
Target Start/End: Complemental strand, 13118 - 13044
Alignment:
190 cacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctc 264  Q
    ||||| ||||||| || |||| ||||||||||  || |  ||||||||||||||||||||| |||||||||||||    
13118 cacttcggttggcttggtggtattggcttgagatctgggagtgtgctcctcctcaaggtctcaggttcgattctc 13044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0291 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: scaffold0291
Description:

Target: scaffold0291; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 230 - 267
Target Start/End: Complemental strand, 2502 - 2465
Alignment:
230 gtgtgctcctcctcaaggtcttaggttcgattctcccc 267  Q
    ||||||||||||||||||||| ||||||||||||||||    
2502 gtgtgctcctcctcaaggtctcaggttcgattctcccc 2465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0337 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: scaffold0337
Description:

Target: scaffold0337; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 193 - 293
Target Start/End: Original strand, 1760 - 1860
Alignment:
193 ttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtggactagttt 292  Q
    ||||||||||||  ||||||||||||| | |||||  || ||||||||||||||||||  ||||| |||||| || ||  |||||| |||||  ||||||    
1760 ttgggttggcctagtggtgttggcttgggaccttggagtttgctcctcctcaaggtctagggttcaattctctccggtatcaatttaggtgggttagttt 1859  T
293 a 293  Q
    |    
1860 a 1860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0172 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: scaffold0172
Description:

Target: scaffold0172; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 15853 - 15745
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||  ||||||||| |||| |||||||| |   |||  || |||||||||||||||||| | ||| |||||||| | |||||||||| |||||     
15853 aacccacttaagttggcctggtggtattggcttgggattttggagtatgctcctcctcaaggtctcaagtttgattctccgcggtgccaatttgggtggg 15754  T
286 ctagtttag 294  Q
    ||| |||||    
15753 ctaatttag 15745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0032 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: scaffold0032
Description:

Target: scaffold0032; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 112282 - 112390
Alignment:
186 aacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctgtgccaatttcggtgga 285  Q
    |||||||||||||||||||| | || ||||||||    || |  ||||| ||||| |  |||||| ||||||||||||| || |||||||||| ||||||    
112282 aacccacttgggttggcctggttgtattggcttggaatctgggagtgtggtcctctttgaggtctgaggttcgattctctccggtgccaatttaggtgga 112381  T
286 ctagtttag 294  Q
    ||| |||||    
112382 ctaatttag 112390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0238 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0238
Description:

Target: scaffold0238; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 233 - 278
Target Start/End: Complemental strand, 2740 - 2695
Alignment:
233 tgctcctcctcaaggtcttaggttcgattctcccctgtgccaattt 278  Q
    |||||||||||||||||| ||||||||||||| |  ||||||||||    
2740 tgctcctcctcaaggtctcaggttcgattctctctggtgccaattt 2695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187 (Bit Score: 30; Significance: 0.0000003; HSPs: 2)
Name: scaffold0187
Description:

Target: scaffold0187; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 293
Target Start/End: Complemental strand, 12499 - 12390
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctg-tgccaatttcggtg 283  Q
    ||||||| ||||||||||||| |||| ||| |||||  |||  | ||||| |||||||||| || | | ||||||||||||| || ||||||||| | ||    
12499 taacccatttgggttggcctggtggtattgacttgaaacctgaaagtgtgatcctcctcaaagtttcaagttcgattctcccttgatgccaatttagatg 12400  T
284 gactagttta 293  Q
    | ||||||||    
12399 ggctagttta 12390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 293
Target Start/End: Complemental strand, 22827 - 22718
Alignment:
185 taacccacttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtcttaggttcgattctcccctg-tgccaatttcggtg 283  Q
    ||||||| ||||||||||||| |||| ||| |||||  |||  | ||||| |||||||||| || | | ||||||||||||| || ||||||||| | ||    
22827 taacccatttgggttggcctggtggtattgacttgaaacctgaaagtgtgatcctcctcaaagtttcaagttcgattctcccttgatgccaatttagatg 22728  T
284 gactagttta 293  Q
    | ||||||||    
22727 ggctagttta 22718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0065
Description:

Target: scaffold0065; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 250
Target Start/End: Original strand, 12196 - 12253
Alignment:
193 ttgggttggcctgatggtgttggcttgagtccttgatgtgtgctcctcctcaaggtct 250  Q
    ||||||||||||  ||||||||||||| | |||||  || ||||||||||||||||||    
12196 ttgggttggcctagtggtgttggcttgggaccttggagtttgctcctcctcaaggtct 12253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110461 times since January 2019
Visitors: 1335