View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-10 (Length: 281)

Name: J5-6-10
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-10
J5-6-10
[»] chr5 (3 HSPs)
chr5 (56-265)||(4891766-4891975)
chr5 (71-141)||(4916665-4916735)
chr5 (1-35)||(4891996-4892030)


Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 56 - 265
Target Start/End: Complemental strand, 4891975 - 4891766
Alignment:
56 gctatgatatggtcctgattatgagccacagacctcttagttccttgtccttgtggctttatagtttcaacgatgttttgtttttgcaatgacccttttc 155  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
4891975 gctatgatatggtcctgattatgagccacagacctcttagttccttgtccttgtggctttatagtttcaacaatgttttgtttttgcaatgacccttttc 4891876  T
156 tattttgaggtaattctgtttgtgacaatggaacaaccttgttcttttttgtatttaaggtacagtcaaaagacagaatctgagaagtggtagaagaagg 255  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4891875 tattttgaggtaattctgtttgtgacaatggaacaaccttgttcttttttgtatttaaggtacagtcaaaagacagaatctgagaagtggtagaagaagg 4891776  T
256 ggaagaagtg 265  Q
    ||||||||||    
4891775 ggaagaagtg 4891766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 71 - 141
Target Start/End: Complemental strand, 4916735 - 4916665
Alignment:
71 tgattatgagccacagacctcttagttccttgtccttgtggctttatagtttcaacgatgttttgtttttg 141  Q
    |||| |||||| |||||||||||||| |||||||||||||  ||| |||||||||| |||||||| |||||    
4916735 tgatcatgagcaacagacctcttagtcccttgtccttgtgtatttttagtttcaacaatgttttgattttg 4916665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 4892030 - 4891996
Alignment:
1 aagagcagctagagcaatcaagcantgactgagtt 35  Q
    |||||||||||||||||||||||| ||||||||||    
4892030 aagagcagctagagcaatcaagcactgactgagtt 4891996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176012 times since January 2019
Visitors: 1577