View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-15 (Length: 922)

Name: J5-6-15
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-15
J5-6-15
[»] chr1 (112 HSPs)
chr1 (331-652)||(26452752-26453073)
chr1 (647-862)||(26452506-26452721)
chr1 (589-652)||(12993554-12993617)
chr1 (590-652)||(12062225-12062287)
chr1 (590-652)||(21852468-21852530)
chr1 (589-652)||(50998334-50998397)
chr1 (590-652)||(1252162-1252224)
chr1 (590-652)||(1358219-1358281)
chr1 (590-652)||(27549092-27549154)
chr1 (590-652)||(48605117-48605179)
chr1 (589-652)||(24023395-24023458)
chr1 (589-652)||(47293280-47293343)
chr1 (590-652)||(2091793-2091855)
chr1 (589-651)||(24015038-24015100)
chr1 (590-652)||(25378288-25378350)
chr1 (590-652)||(26660675-26660737)
chr1 (590-652)||(33738210-33738272)
chr1 (590-652)||(34037967-34038029)
chr1 (590-652)||(34061990-34062052)
chr1 (590-652)||(37255173-37255235)
chr1 (590-652)||(39015610-39015672)
chr1 (238-275)||(26452737-26452774)
chr1 (590-651)||(35838766-35838827)
chr1 (590-650)||(5852719-5852779)
chr1 (590-650)||(6763383-6763443)
chr1 (590-650)||(46517994-46518054)
chr1 (589-652)||(25378304-25378367)
chr1 (589-652)||(31909796-31909859)
chr1 (589-652)||(38824321-38824384)
chr1 (589-652)||(52879914-52879977)
chr1 (590-652)||(4682968-4683030)
chr1 (590-652)||(4974092-4974154)
chr1 (590-652)||(5852735-5852797)
chr1 (590-652)||(26059166-26059228)
chr1 (590-652)||(27549076-27549138)
chr1 (591-649)||(29070667-29070725)
chr1 (589-651)||(31919888-31919950)
chr1 (591-649)||(38190898-38190956)
chr1 (590-652)||(39015594-39015656)
chr1 (590-652)||(40907226-40907288)
chr1 (589-651)||(41621338-41621400)
chr1 (590-652)||(45239022-45239084)
chr1 (590-652)||(46517976-46518038)
chr1 (590-652)||(47011275-47011337)
chr1 (611-652)||(7230111-7230152)
chr1 (590-651)||(15998242-15998303)
chr1 (590-651)||(31481896-31481957)
chr1 (594-651)||(31919875-31919932)
chr1 (590-651)||(34120945-34121006)
chr1 (591-652)||(34598894-34598955)
chr1 (590-651)||(42761264-42761325)
chr1 (591-652)||(43384530-43384591)
chr1 (590-651)||(45925292-45925353)
chr1 (590-651)||(47912603-47912664)
chr1 (609-653)||(4798930-4798974)
chr1 (590-650)||(26040411-26040471)
chr1 (590-654)||(28237117-28237181)
chr1 (590-650)||(40907210-40907270)
chr1 (589-649)||(49586277-49586337)
chr1 (589-652)||(1252178-1252241)
chr1 (589-652)||(6169857-6169920)
chr1 (589-652)||(8751462-8751525)
chr1 (589-652)||(12062241-12062304)
chr1 (589-652)||(17310465-17310528)
chr1 (588-651)||(17387698-17387761)
chr1 (589-652)||(24478695-24478758)
chr1 (609-652)||(28237122-28237165)
chr1 (590-652)||(42140379-42140439)
chr1 (589-652)||(51138888-51138951)
chr1 (590-652)||(3160781-3160843)
chr1 (590-652)||(6763365-6763427)
chr1 (590-652)||(12447485-12447547)
chr1 (590-652)||(21909872-21909934)
chr1 (590-652)||(21909888-21909950)
chr1 (589-651)||(24286813-24286875)
chr1 (590-652)||(26660691-26660753)
chr1 (590-652)||(27552277-27552339)
chr1 (590-652)||(31909780-31909842)
chr1 (590-652)||(37255157-37255219)
chr1 (591-645)||(40960771-40960825)
chr1 (589-651)||(42788376-42788438)
chr1 (609-651)||(42914584-42914626)
chr1 (590-652)||(47011291-47011353)
chr1 (590-652)||(48605101-48605163)
chr1 (590-652)||(51138905-51138967)
chr1 (590-651)||(435237-435298)
chr1 (590-651)||(435254-435315)
chr1 (610-651)||(9135569-9135610)
chr1 (590-651)||(9947802-9947863)
chr1 (590-647)||(13911330-13911387)
chr1 (590-651)||(15278613-15278674)
chr1 (590-651)||(15311520-15311581)
chr1 (590-651)||(15998259-15998320)
chr1 (590-651)||(17387681-17387742)
chr1 (590-651)||(18023661-18023722)
chr1 (590-651)||(22954803-22954864)
chr1 (590-651)||(22954820-22954881)
chr1 (590-651)||(24015056-24015117)
chr1 (590-651)||(24286796-24286857)
chr1 (597-654)||(25267892-25267949)
chr1 (590-651)||(26040428-26040489)
chr1 (590-651)||(26856021-26856082)
chr1 (590-651)||(31327598-31327659)
chr1 (594-651)||(31327615-31327672)
chr1 (590-651)||(34662436-34662497)
chr1 (590-651)||(37215203-37215264)
chr1 (591-652)||(38824338-38824399)
chr1 (590-651)||(38847350-38847411)
chr1 (590-652)||(39181080-39181144)
chr1 (590-652)||(39181096-39181160)
chr1 (590-651)||(41649580-41649641)
chr1 (590-651)||(47912620-47912681)
[»] chr6 (60 HSPs)
chr6 (1-160)||(5751851-5752010)
chr6 (152-240)||(5752482-5752570)
chr6 (53-160)||(5852466-5852573)
chr6 (590-652)||(32786147-32786209)
chr6 (590-652)||(3343824-3343886)
chr6 (590-652)||(3418803-3418865)
chr6 (589-651)||(29318096-29318158)
chr6 (54-158)||(5763640-5763744)
chr6 (54-158)||(5767175-5767279)
chr6 (54-158)||(5770710-5770814)
chr6 (54-158)||(5774245-5774349)
chr6 (54-158)||(5777780-5777884)
chr6 (54-158)||(5781315-5781419)
chr6 (54-158)||(5784850-5784954)
chr6 (54-158)||(5788385-5788489)
chr6 (54-158)||(5791920-5792024)
chr6 (54-158)||(5795455-5795559)
chr6 (54-158)||(5798990-5799094)
chr6 (54-158)||(5802525-5802629)
chr6 (54-158)||(5806060-5806164)
chr6 (54-158)||(5809595-5809699)
chr6 (54-158)||(5813130-5813234)
chr6 (54-158)||(5816665-5816769)
chr6 (54-158)||(5820200-5820304)
chr6 (589-652)||(667758-667821)
chr6 (57-160)||(5879906-5880009)
chr6 (590-649)||(9908186-9908245)
chr6 (590-652)||(3212272-3212334)
chr6 (54-160)||(5829523-5829629)
chr6 (590-652)||(7418906-7418968)
chr6 (590-652)||(21478584-21478646)
chr6 (589-651)||(32710120-32710182)
chr6 (590-651)||(12290976-12291037)
chr6 (590-651)||(14897078-14897139)
chr6 (590-651)||(26597196-26597257)
chr6 (590-651)||(28034046-28034107)
chr6 (590-652)||(5433378-5433440)
chr6 (590-652)||(6048003-6048065)
chr6 (590-652)||(9908167-9908229)
chr6 (609-651)||(10118666-10118708)
chr6 (590-652)||(26498624-26498686)
chr6 (589-651)||(29938398-29938460)
chr6 (590-652)||(32786163-32786225)
chr6 (590-651)||(2693693-2693754)
chr6 (590-651)||(2693710-2693771)
chr6 (590-651)||(25371035-25371096)
chr6 (590-651)||(25371052-25371113)
chr6 (590-651)||(26597213-26597274)
chr6 (590-651)||(28034063-28034124)
chr6 (589-652)||(3343807-3343870)
chr6 (590-649)||(30507049-30507108)
chr6 (609-652)||(31759374-31759417)
chr6 (589-652)||(32161611-32161674)
chr6 (590-652)||(3418787-3418849)
chr6 (591-652)||(667775-667836)
chr6 (590-651)||(10118649-10118710)
chr6 (590-651)||(10731521-10731582)
chr6 (590-651)||(11213264-11213325)
chr6 (590-651)||(12588814-12588875)
chr6 (590-651)||(13902071-13902131)
[»] scaffold0127 (2 HSPs)
scaffold0127 (1-160)||(17832-17992)
scaffold0127 (152-240)||(17434-17518)
[»] chr4 (114 HSPs)
chr4 (590-652)||(30162658-30162720)
chr4 (589-652)||(32112344-32112407)
chr4 (590-645)||(34459039-34459094)
chr4 (590-652)||(24529604-24529666)
chr4 (590-652)||(44639793-44639855)
chr4 (589-652)||(4711436-4711499)
chr4 (589-652)||(41788968-41789031)
chr4 (597-652)||(53508547-53508602)
chr4 (597-652)||(53551633-53551688)
chr4 (589-651)||(171176-171238)
chr4 (590-652)||(9968332-9968394)
chr4 (590-652)||(11583754-11583816)
chr4 (590-652)||(13743905-13743967)
chr4 (590-652)||(17028264-17028326)
chr4 (590-652)||(17659512-17659574)
chr4 (590-652)||(26206625-26206687)
chr4 (598-652)||(33084764-33084818)
chr4 (589-651)||(40545344-40545406)
chr4 (590-652)||(48042638-48042700)
chr4 (590-652)||(50519309-50519371)
chr4 (591-649)||(54787014-54787072)
chr4 (590-651)||(7695177-7695238)
chr4 (590-651)||(34709623-34709684)
chr4 (589-650)||(54569405-54569466)
chr4 (590-652)||(12721676-12721739)
chr4 (590-652)||(12721692-12721755)
chr4 (590-649)||(24156170-24156229)
chr4 (589-652)||(41788951-41789014)
chr4 (589-652)||(49745493-49745556)
chr4 (590-652)||(16200198-16200259)
chr4 (590-652)||(16450206-16450268)
chr4 (590-652)||(19754246-19754308)
chr4 (590-652)||(19785498-19785560)
chr4 (590-652)||(23329401-23329463)
chr4 (590-652)||(23710882-23710944)
chr4 (590-652)||(23754239-23754301)
chr4 (590-652)||(25856041-25856103)
chr4 (590-652)||(29978523-29978585)
chr4 (598-652)||(29978539-29978593)
chr4 (590-652)||(30051374-30051436)
chr4 (590-652)||(30279171-30279233)
chr4 (589-651)||(42546017-42546079)
chr4 (590-652)||(43635867-43635929)
chr4 (590-652)||(44639777-44639839)
chr4 (589-651)||(48796206-48796267)
chr4 (590-652)||(51126136-51126198)
chr4 (590-652)||(55501233-55501295)
chr4 (590-651)||(171159-171220)
chr4 (590-651)||(2994752-2994813)
chr4 (590-651)||(8014214-8014275)
chr4 (590-651)||(15641271-15641332)
chr4 (590-651)||(18327965-18328026)
chr4 (590-651)||(18437373-18437434)
chr4 (590-651)||(18592393-18592454)
chr4 (590-651)||(26185899-26185960)
chr4 (590-651)||(31808353-31808414)
chr4 (591-652)||(32112361-32112422)
chr4 (590-651)||(45861036-45861097)
chr4 (590-651)||(45861053-45861114)
chr4 (590-651)||(54927153-54927214)
chr4 (589-652)||(23754222-23754285)
chr4 (590-649)||(25856060-25856119)
chr4 (589-652)||(33659802-33659865)
chr4 (589-652)||(42013193-42013256)
chr4 (589-651)||(2994769-2994831)
chr4 (590-652)||(16391721-16391783)
chr4 (590-652)||(17659496-17659558)
chr4 (609-651)||(18327982-18328024)
chr4 (609-651)||(18437375-18437417)
chr4 (590-652)||(23329417-23329479)
chr4 (590-652)||(23710866-23710928)
chr4 (590-652)||(26185915-26185977)
chr4 (590-652)||(26206641-26206703)
chr4 (590-652)||(30051390-30051452)
chr4 (590-648)||(36235729-36235787)
chr4 (591-629)||(37431909-37431947)
chr4 (609-651)||(38616460-38616502)
chr4 (590-652)||(39294204-39294266)
chr4 (590-652)||(39294220-39294282)
chr4 (590-652)||(43635883-43635945)
chr4 (590-652)||(44551245-44551307)
chr4 (590-652)||(46996521-46996583)
chr4 (590-652)||(48079547-48079609)
chr4 (590-652)||(50038481-50038543)
chr4 (590-652)||(50038497-50038559)
chr4 (590-652)||(50045703-50045765)
chr4 (590-652)||(50045719-50045781)
chr4 (590-652)||(51126152-51126214)
chr4 (590-652)||(53019183-53019245)
chr4 (590-652)||(53403022-53403084)
chr4 (590-652)||(53508531-53508593)
chr4 (590-652)||(55131567-55131629)
chr4 (590-652)||(55501249-55501311)
chr4 (589-651)||(55616845-55616907)
chr4 (589-651)||(55624149-55624211)
chr4 (590-652)||(56420462-56420524)
chr4 (590-652)||(56420478-56420540)
chr4 (590-651)||(7695160-7695221)
chr4 (590-651)||(9011776-9011837)
chr4 (590-651)||(18592376-18592437)
chr4 (590-651)||(20787587-20787648)
chr4 (590-651)||(30279188-30279249)
chr4 (590-651)||(33032917-33032978)
chr4 (590-651)||(34321413-34321474)
chr4 (590-651)||(34709606-34709667)
chr4 (610-651)||(36235729-36235770)
chr4 (590-651)||(39466735-39466795)
chr4 (590-651)||(39466752-39466812)
chr4 (590-651)||(39923851-39923912)
chr4 (589-650)||(42546036-42546097)
chr4 (590-651)||(42911646-42911707)
chr4 (590-651)||(47628329-47628390)
chr4 (590-651)||(53684833-53684894)
chr4 (590-651)||(54927136-54927197)
[»] chr5 (90 HSPs)
chr5 (589-652)||(36329110-36329173)
chr5 (590-652)||(34186386-34186448)
chr5 (589-652)||(24433582-24433645)
chr5 (589-652)||(38860830-38860893)
chr5 (589-651)||(6168727-6168789)
chr5 (590-652)||(15966674-15966736)
chr5 (590-652)||(43585526-43585588)
chr5 (589-652)||(14571055-14571118)
chr5 (589-652)||(18942033-18942096)
chr5 (590-652)||(7336902-7336964)
chr5 (589-651)||(8408821-8408883)
chr5 (589-651)||(16056793-16056855)
chr5 (590-652)||(31787249-31787311)
chr5 (590-652)||(31947481-31947543)
chr5 (590-652)||(36964261-36964323)
chr5 (590-652)||(43585542-43585604)
chr5 (590-651)||(8618445-8618506)
chr5 (590-651)||(13461581-13461642)
chr5 (590-651)||(18753659-18753720)
chr5 (590-650)||(26168237-26168297)
chr5 (589-652)||(1723273-1723336)
chr5 (589-652)||(14571038-14571101)
chr5 (589-652)||(23118179-23118242)
chr5 (592-651)||(40271325-40271384)
chr5 (590-652)||(1723290-1723352)
chr5 (590-652)||(3161257-3161319)
chr5 (589-651)||(4162851-4162913)
chr5 (590-652)||(9247009-9247071)
chr5 (590-652)||(14064841-14064903)
chr5 (590-652)||(14064857-14064919)
chr5 (590-652)||(15966003-15966065)
chr5 (590-652)||(18942017-18942079)
chr5 (590-652)||(21152619-21152681)
chr5 (590-652)||(21159754-21159816)
chr5 (590-652)||(21163561-21163623)
chr5 (590-652)||(26168219-26168281)
chr5 (590-652)||(34186402-34186464)
chr5 (589-651)||(43176281-43176343)
chr5 (590-652)||(43340462-43340524)
chr5 (590-651)||(5226067-5226128)
chr5 (590-651)||(8618428-8618489)
chr5 (590-651)||(13461598-13461659)
chr5 (590-651)||(18003888-18003949)
chr5 (590-651)||(21344480-21344541)
chr5 (590-651)||(21344497-21344558)
chr5 (591-652)||(34102122-34102183)
chr5 (589-638)||(40680301-40680350)
chr5 (590-651)||(40914144-40914205)
chr5 (589-652)||(9984968-9985031)
chr5 (590-649)||(24089073-24089132)
chr5 (590-645)||(27304791-27304846)
chr5 (589-652)||(32067942-32068005)
chr5 (589-652)||(34102105-34102168)
chr5 (589-652)||(35907862-35907925)
chr5 (589-652)||(42480507-42480570)
chr5 (590-652)||(3161273-3161335)
chr5 (589-651)||(3709432-3709494)
chr5 (590-652)||(6638295-6638357)
chr5 (590-652)||(6638311-6638373)
chr5 (590-652)||(15965987-15966049)
chr5 (590-652)||(15966690-15966752)
chr5 (591-645)||(17096497-17096551)
chr5 (590-652)||(21152635-21152697)
chr5 (590-652)||(21159770-21159832)
chr5 (590-652)||(21163577-21163639)
chr5 (590-652)||(23118196-23118258)
chr5 (590-652)||(27304768-27304830)
chr5 (609-651)||(30114317-30114359)
chr5 (590-652)||(31787265-31787327)
chr5 (589-651)||(32146875-32146937)
chr5 (589-651)||(33545841-33545903)
chr5 (590-652)||(35067950-35068012)
chr5 (589-651)||(35469426-35469488)
chr5 (590-652)||(40208508-40208570)
chr5 (590-651)||(566341-566402)
chr5 (590-651)||(4162834-4162895)
chr5 (590-651)||(5226050-5226111)
chr5 (590-651)||(6168710-6168771)
chr5 (590-651)||(7581433-7581494)
chr5 (589-650)||(9984951-9985012)
chr5 (590-651)||(12891319-12891380)
chr5 (590-651)||(13359192-13359253)
chr5 (590-651)||(14274182-14274243)
chr5 (590-651)||(18003905-18003966)
chr5 (590-651)||(21369304-21369365)
chr5 (590-651)||(31691004-31691065)
chr5 (590-651)||(31758916-31758977)
chr5 (590-651)||(37039740-37039801)
chr5 (590-651)||(40905895-40905956)
chr5 (590-651)||(41062523-41062584)
[»] chr2 (84 HSPs)
chr2 (589-652)||(32070491-32070554)
chr2 (590-652)||(37486046-37486108)
chr2 (589-652)||(40739539-40739602)
chr2 (591-652)||(34240856-34240916)
chr2 (589-652)||(27327877-27327940)
chr2 (589-652)||(29573861-29573924)
chr2 (590-652)||(5144299-5144361)
chr2 (590-652)||(24971236-24971298)
chr2 (590-652)||(30202515-30202577)
chr2 (590-652)||(34466145-34466207)
chr2 (590-652)||(40340500-40340562)
chr2 (590-652)||(40739523-40739585)
chr2 (590-652)||(43514787-43514849)
chr2 (590-651)||(3094952-3095013)
chr2 (590-651)||(7728481-7728542)
chr2 (590-651)||(21208940-21209001)
chr2 (609-652)||(2795360-2795403)
chr2 (609-652)||(5204939-5204982)
chr2 (589-652)||(17378102-17378165)
chr2 (590-649)||(28602197-28602256)
chr2 (589-652)||(34911128-34911191)
chr2 (589-651)||(85732-85794)
chr2 (590-652)||(2795357-2795419)
chr2 (590-652)||(4898196-4898258)
chr2 (590-652)||(4945590-4945652)
chr2 (590-652)||(8554702-8554764)
chr2 (590-652)||(17843982-17844044)
chr2 (590-652)||(17843998-17844060)
chr2 (590-652)||(20195320-20195382)
chr2 (590-652)||(20195336-20195398)
chr2 (609-651)||(25899406-25899448)
chr2 (590-652)||(29771765-29771827)
chr2 (590-652)||(34911145-34911207)
chr2 (590-652)||(36490526-36490588)
chr2 (590-652)||(40320163-40320225)
chr2 (590-652)||(42579066-42579128)
chr2 (590-651)||(4184756-4184817)
chr2 (590-651)||(5094871-5094932)
chr2 (590-651)||(5094888-5094949)
chr2 (591-652)||(10099599-10099660)
chr2 (590-651)||(15080886-15080947)
chr2 (590-651)||(18468989-18469050)
chr2 (590-651)||(19908553-19908614)
chr2 (590-651)||(22352491-22352552)
chr2 (590-651)||(27692650-27692711)
chr2 (591-652)||(32070508-32070569)
chr2 (590-651)||(33363607-33363668)
chr2 (590-651)||(44402132-44402193)
chr2 (590-651)||(44949373-44949434)
chr2 (590-650)||(9709689-9709749)
chr2 (590-650)||(24971254-24971314)
chr2 (592-647)||(7105147-7105202)
chr2 (589-652)||(8382828-8382891)
chr2 (589-652)||(9709705-9709768)
chr2 (590-649)||(19908536-19908595)
chr2 (589-652)||(32473501-32473564)
chr2 (617-652)||(34438792-34438827)
chr2 (589-651)||(3094969-3095031)
chr2 (590-652)||(5144315-5144377)
chr2 (590-652)||(5204923-5204985)
chr2 (590-652)||(8554718-8554780)
chr2 (590-652)||(9158005-9158067)
chr2 (609-651)||(18967274-18967316)
chr2 (589-651)||(20556634-20556696)
chr2 (590-652)||(25668442-25668504)
chr2 (590-652)||(25668458-25668520)
chr2 (590-652)||(26567667-26567729)
chr2 (590-652)||(27327861-27327923)
chr2 (590-652)||(29771749-29771811)
chr2 (590-652)||(34466129-34466191)
chr2 (590-652)||(36490510-36490572)
chr2 (598-652)||(38721430-38721484)
chr2 (590-648)||(40340520-40340578)
chr2 (590-652)||(43514803-43514865)
chr2 (590-651)||(4184773-4184834)
chr2 (590-651)||(6006730-6006791)
chr2 (589-650)||(14394811-14394872)
chr2 (589-650)||(14394830-14394891)
chr2 (590-651)||(18468972-18469033)
chr2 (590-651)||(21208923-21208984)
chr2 (590-651)||(33363590-33363651)
chr2 (591-652)||(37396251-37396312)
chr2 (590-651)||(42230553-42230614)
chr2 (590-651)||(44402115-44402176)
[»] chr8 (70 HSPs)
chr8 (590-652)||(37922859-37922921)
chr8 (590-652)||(40802250-40802312)
chr8 (589-652)||(3611799-3611862)
chr8 (589-652)||(26492339-26492402)
chr8 (589-652)||(44838821-44838884)
chr8 (590-652)||(8568867-8568929)
chr8 (598-652)||(13832055-13832109)
chr8 (590-652)||(39655448-39655510)
chr8 (590-652)||(43483963-43484025)
chr8 (589-649)||(5419565-5419625)
chr8 (592-652)||(44282298-44282358)
chr8 (591-649)||(19293048-19293106)
chr8 (590-652)||(34188349-34188411)
chr8 (590-652)||(34194607-34194669)
chr8 (590-652)||(35063507-35063569)
chr8 (590-651)||(27184262-27184323)
chr8 (592-652)||(5040115-5040175)
chr8 (589-649)||(5419545-5419605)
chr8 (589-652)||(38883976-38884039)
chr8 (589-651)||(2827404-2827466)
chr8 (590-648)||(3270665-3270723)
chr8 (590-652)||(26492356-26492418)
chr8 (590-652)||(27781931-27781993)
chr8 (590-652)||(35447815-35447877)
chr8 (590-652)||(37922843-37922905)
chr8 (590-652)||(39655464-39655526)
chr8 (590-652)||(41178005-41178067)
chr8 (590-652)||(42631810-42631872)
chr8 (589-651)||(42666147-42666209)
chr8 (590-652)||(43483979-43484041)
chr8 (590-651)||(5420235-5420296)
chr8 (590-647)||(35201928-35201985)
chr8 (590-650)||(8769672-8769732)
chr8 (590-649)||(33934129-33934186)
chr8 (591-651)||(36593491-36593551)
chr8 (592-652)||(42631826-42631886)
chr8 (590-649)||(2552848-2552907)
chr8 (609-652)||(15715077-15715120)
chr8 (609-652)||(20524213-20524256)
chr8 (589-652)||(26489652-26489715)
chr8 (589-652)||(42795125-42795188)
chr8 (590-652)||(8568851-8568913)
chr8 (589-651)||(9331319-9331381)
chr8 (590-652)||(11301990-11302052)
chr8 (590-652)||(11302937-11302999)
chr8 (589-651)||(13832503-13832565)
chr8 (591-649)||(14053008-14053066)
chr8 (590-652)||(15715074-15715136)
chr8 (590-652)||(24726066-24726128)
chr8 (609-651)||(26191819-26191861)
chr8 (598-652)||(32032988-32033042)
chr8 (590-652)||(34194591-34194653)
chr8 (590-652)||(35447831-35447893)
chr8 (590-652)||(35969709-35969771)
chr8 (590-652)||(38883993-38884055)
chr8 (590-652)||(40716777-40716839)
chr8 (590-652)||(40802234-40802296)
chr8 (590-652)||(42149157-42149219)
chr8 (589-651)||(42666165-42666227)
chr8 (589-651)||(45145650-45145712)
chr8 (590-651)||(1647088-1647149)
chr8 (590-652)||(2552833-2552891)
chr8 (591-652)||(5040100-5040161)
chr8 (614-651)||(5526552-5526589)
chr8 (590-651)||(32016822-32016883)
chr8 (590-651)||(36314889-36314950)
chr8 (590-651)||(38815851-38815912)
chr8 (590-651)||(44872296-44872357)
chr8 (590-651)||(45441133-45441194)
chr8 (590-651)||(45441150-45441211)
[»] scaffold0013 (2 HSPs)
scaffold0013 (590-649)||(58350-58409)
scaffold0013 (590-652)||(58331-58393)
[»] chr3 (75 HSPs)
chr3 (589-652)||(43898140-43898203)
chr3 (589-652)||(44435204-44435267)
chr3 (590-652)||(23783347-23783409)
chr3 (590-652)||(32589346-32589408)
chr3 (589-652)||(13083901-13083964)
chr3 (589-652)||(47900296-47900359)
chr3 (590-652)||(16127795-16127857)
chr3 (590-652)||(22995743-22995805)
chr3 (590-652)||(24599910-24599972)
chr3 (590-652)||(26043297-26043359)
chr3 (590-652)||(32998515-32998577)
chr3 (590-652)||(39530426-39530488)
chr3 (590-652)||(44435221-44435283)
chr3 (590-652)||(51760200-51760262)
chr3 (590-651)||(16607402-16607463)
chr3 (591-652)||(29076557-29076618)
chr3 (590-651)||(38446787-38446847)
chr3 (591-652)||(47931722-47931782)
chr3 (589-652)||(8126177-8126240)
chr3 (589-652)||(53717927-53717990)
chr3 (590-652)||(16127779-16127841)
chr3 (590-652)||(17072634-17072696)
chr3 (590-652)||(21659185-21659247)
chr3 (589-651)||(25990697-25990759)
chr3 (590-652)||(32589362-32589424)
chr3 (590-652)||(32833711-32833773)
chr3 (590-652)||(34205594-34205656)
chr3 (589-651)||(39333320-39333382)
chr3 (590-652)||(40326485-40326547)
chr3 (590-652)||(53717944-53718006)
chr3 (589-651)||(54008237-54008299)
chr3 (590-651)||(13927443-13927504)
chr3 (591-652)||(19678994-19679055)
chr3 (589-650)||(23005045-23005106)
chr3 (590-651)||(33638962-33639023)
chr3 (590-651)||(38082545-38082606)
chr3 (590-651)||(39333338-39333399)
chr3 (590-651)||(43883911-43883972)
chr3 (590-650)||(7680168-7680228)
chr3 (609-652)||(14626678-14626721)
chr3 (589-652)||(17501435-17501498)
chr3 (609-652)||(32998518-32998561)
chr3 (589-652)||(40760801-40760864)
chr3 (590-653)||(42595783-42595846)
chr3 (589-652)||(51760216-51760279)
chr3 (589-652)||(54680536-54680599)
chr3 (589-651)||(4236689-4236750)
chr3 (609-651)||(7680169-7680211)
chr3 (590-652)||(8126371-8126433)
chr3 (589-652)||(17004988-17005053)
chr3 (590-652)||(18480907-18480969)
chr3 (590-652)||(18480923-18480985)
chr3 (590-652)||(22995727-22995789)
chr3 (589-651)||(24226236-24226298)
chr3 (609-651)||(24312612-24312654)
chr3 (590-652)||(34935569-34935631)
chr3 (590-652)||(39289592-39289654)
chr3 (598-652)||(40326477-40326531)
chr3 (239-277)||(48861916-48861954)
chr3 (590-652)||(54680520-54680582)
chr3 (590-652)||(54690485-54690547)
chr3 (590-651)||(1927549-1927610)
chr3 (590-651)||(13927426-13927487)
chr3 (598-651)||(14626676-14626729)
chr3 (590-651)||(35455594-35455655)
chr3 (590-651)||(35455611-35455672)
chr3 (590-651)||(38082562-38082623)
chr3 (590-651)||(39148720-39148781)
chr3 (590-651)||(42957865-42957926)
chr3 (590-651)||(46967505-46967566)
chr3 (590-651)||(47342613-47342674)
chr3 (590-651)||(47342630-47342691)
chr3 (590-651)||(48909082-48909143)
chr3 (591-652)||(52638065-52638126)
chr3 (590-651)||(54008469-54008530)
[»] chr7 (64 HSPs)
chr7 (591-652)||(35593688-35593749)
chr7 (590-650)||(24166294-24166354)
chr7 (589-652)||(27940775-27940838)
chr7 (589-652)||(33471520-33471583)
chr7 (590-649)||(35160780-35160839)
chr7 (598-652)||(11032342-11032396)
chr7 (590-652)||(37066213-37066275)
chr7 (591-649)||(39970189-39970247)
chr7 (590-652)||(43067055-43067117)
chr7 (590-652)||(46477164-46477226)
chr7 (590-652)||(48590632-48590694)
chr7 (590-651)||(41699087-41699148)
chr7 (589-651)||(2927216-2927278)
chr7 (590-652)||(3498325-3498387)
chr7 (590-652)||(3498341-3498403)
chr7 (590-652)||(11032350-11032412)
chr7 (589-651)||(12307865-12307927)
chr7 (590-652)||(19532000-19532062)
chr7 (590-652)||(24211582-24211644)
chr7 (590-652)||(27234905-27234967)
chr7 (590-652)||(27942372-27942434)
chr7 (590-652)||(30005923-30005985)
chr7 (591-649)||(31549825-31549883)
chr7 (590-652)||(36711586-36711648)
chr7 (590-652)||(37066229-37066291)
chr7 (590-652)||(40116187-40116249)
chr7 (589-651)||(41890053-41890115)
chr7 (590-652)||(45833221-45833283)
chr7 (590-652)||(46221109-46221171)
chr7 (590-652)||(46477180-46477242)
chr7 (590-651)||(6580553-6580614)
chr7 (590-651)||(24043127-24043188)
chr7 (590-651)||(25486764-25486825)
chr7 (590-651)||(26153963-26154024)
chr7 (590-651)||(34907696-34907757)
chr7 (590-651)||(41888760-41888821)
chr7 (590-650)||(10300852-10300912)
chr7 (593-645)||(16086237-16086289)
chr7 (589-652)||(1565459-1565522)
chr7 (589-652)||(16086250-16086312)
chr7 (609-652)||(24733162-24733205)
chr7 (589-652)||(33471537-33471600)
chr7 (589-652)||(35593671-35593734)
chr7 (589-652)||(46221125-46221188)
chr7 (590-652)||(1565443-1565505)
chr7 (591-645)||(3838151-3838205)
chr7 (609-651)||(7208714-7208756)
chr7 (590-652)||(19531984-19532046)
chr7 (589-651)||(24043109-24043171)
chr7 (590-652)||(27940792-27940854)
chr7 (590-652)||(28003225-28003287)
chr7 (591-649)||(31549843-31549901)
chr7 (590-652)||(46578312-46578374)
chr7 (590-652)||(46658763-46658825)
chr7 (590-651)||(2927234-2927295)
chr7 (591-648)||(18732244-18732301)
chr7 (591-652)||(18732259-18732319)
chr7 (246-291)||(19403579-19403624)
chr7 (590-651)||(24166147-24166208)
chr7 (590-651)||(24166164-24166225)
chr7 (590-651)||(28324751-28324812)
chr7 (597-638)||(40069440-40069481)
chr7 (591-652)||(46470984-46471045)
chr7 (590-651)||(48135497-48135558)
[»] scaffold0111 (2 HSPs)
scaffold0111 (593-652)||(38041-38100)
scaffold0111 (590-650)||(38056-38116)
[»] scaffold0172 (2 HSPs)
scaffold0172 (590-652)||(11615-11677)
scaffold0172 (590-652)||(11631-11693)
[»] scaffold0087 (1 HSPs)
scaffold0087 (54-160)||(33595-33701)
[»] scaffold0340 (1 HSPs)
scaffold0340 (590-652)||(14080-14142)
[»] scaffold0321 (2 HSPs)
scaffold0321 (589-651)||(1663-1725)
scaffold0321 (590-651)||(1681-1742)
[»] scaffold0136 (1 HSPs)
scaffold0136 (594-651)||(22479-22536)
[»] scaffold0036 (2 HSPs)
scaffold0036 (590-650)||(36459-36519)
scaffold0036 (590-651)||(36441-36502)
[»] scaffold0018 (1 HSPs)
scaffold0018 (591-651)||(48904-48964)
[»] scaffold0633 (1 HSPs)
scaffold0633 (590-651)||(5355-5416)
[»] scaffold0121 (1 HSPs)
scaffold0121 (590-651)||(17482-17543)
[»] scaffold0047 (1 HSPs)
scaffold0047 (590-651)||(65951-66012)


Alignment Details
Target: chr1 (Bit Score: 322; Significance: 0; HSPs: 112)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 331 - 652
Target Start/End: Original strand, 26452752 - 26453073
Alignment:
331 taatctcaacttgtgatttggaattccggaagtaataattgaattatatagatcgcggaccttgctttgcagtaagcatatatcaaagaaaaagtctgct 430  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26452752 taatctcaacttgtgatttggaattccggaagtaataattgaattatatagatcgcggaccttgctttgcagtaagcatatatcaaagaaaaagtctgct 26452851  T
431 atcattcgatgcaatgcagtaagcatatatcacacaaatcaactgtctccatgtgtgttttttcaagaaaaaatctgctaaattttgatgcaagttcact 530  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26452852 atcattcgatgcaatgcagtaagcatatatcacacaaatcaactgtctccatgtgtgttttttcaagaaaaaatctgctaaattttgatgcaagttcact 26452951  T
531 aatatttactctctccaatcctttttataagaaacaaaaatgacaattttttgggttcttttttaggttcattcaaccaatgatatatgtggttcatatt 630  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26452952 aatatttactctctccaatcctttttataagaaacaaaaatgacaattttttgggttcttttttaggttcattcaaccaatgatatatgtggttcatatt 26453051  T
631 atggaccatatacatcattaat 652  Q
    ||||||||||||||||||||||    
26453052 atggaccatatacatcattaat 26453073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 161; E-Value: 2e-85
Query Start/End: Original strand, 647 - 862
Target Start/End: Original strand, 26452506 - 26452721
Alignment:
647 attaataattattacaaatgaaatagatnaaggaaattggctctgttgaaattttaatgaaatttttacatcagaagggggcaaagttaaccttggcata 746  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
26452506 attaataattattacaaatgaaatagataaaggaaattggctctgttgaaattttaatgaaatttttacatcagaaggtggcaaagttaaccttggcata 26452605  T
747 aaaactttatcaccgatattacttcttgatacnacctttcattcaagcacatattttcncgtcttggttataatcaggcntggtnccntggtttaanccn 846  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| ||||||||||| | | || || | |||||| ||     
26452606 aaaactttatcaccgatattacttcttgatacaacctttcattcaagcacatattttctcgtctttgttataatcagtctt-gttccattgtttaatcct 26452704  T
847 aaa-tttgatctataat 862  Q
    ||| |||||||||||||    
26452705 aaattttgatctataat 26452721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 12993554 - 12993617
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||||  |||||| ||||||||||||||||||||||| |||||||||||||    
12993554 ttttttaggttcattcaattaatgatgtatgtggttcatattatggaccacatacatcattaat 12993617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 12062225 - 12062287
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||||||||||||||||| ||||||||| |||||||||||||    
12062225 tttttaggttcattcaattaatgatatatgtggttcataatatggaccacatacatcattaat 12062287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 21852468 - 21852530
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  ||||||||||||||||||||||||||| || |||||||||||||    
21852468 tttttaggttcattcaattaatgatatatgtggttcatattatggatcacatacatcattaat 21852530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 50998334 - 50998397
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||||  |||||| ||| ||||||||||||||||| |||||||||||||||    
50998334 ttttttaggttcattcaattaatgatgtatttggttcatattatggactatatacatcattaat 50998397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 1252162 - 1252224
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| |||||||||||||||||||||||  ||||||||||||    
1252162 tttttaggttcattcaattaatgatgtatgtggttcatattatggaccacgtacatcattaat 1252224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 1358281 - 1358219
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||| |||||||||||| |||||| ||||||||||||| ||||||||| |||||||||||||    
1358281 ttttttggttcattcaactaatgatgtatgtggttcataatatggaccacatacatcattaat 1358219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 27549154 - 27549092
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||||||| ||||||||| |||||||||||||    
27549154 tttttaggttcattcaattaatgatgtatgtggttcataatatggaccacatacatcattaat 27549092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 48605179 - 48605117
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| |||||| |||||||||||||||| |||||||||||||    
48605179 tttttaggttcattcaattaatgatgtatgtgattcatattatggaccacatacatcattaat 48605117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 24023395 - 24023458
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||| ||||||  ||||||||| ||||||||||||||| ||| ||||||||||||||    
24023395 ttttttaggtttattcaattaatgatatacgtggttcatattatgaaccgtatacatcattaat 24023458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 47293280 - 47293343
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||| |||||||||  |||||| |||||||||||||||||||| || |||||||||||||    
47293280 ttttttagattcattcaattaatgatgtatgtggttcatattatggatcacatacatcattaat 47293343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 2091855 - 2091793
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  ||| || |||||| |||||||||| |||||||||||||||||||    
2091855 tttttaggttcattcaattaatcatgtatgtgattcatattattgaccatatacatcattaat 2091793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 589 - 651
Target Start/End: Original strand, 24015038 - 24015100
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||||||   |||||| |||||||||||||||||| |||| ||||||||||||    
24015038 ttttttaggttcattcatttaatgatgtatgtggttcatattatgaaccacatacatcattaa 24015100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 25378288 - 25378350
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||||||| ||| ||||| |||||||||||||    
25378288 tttttaggttcattcaattaatgatgtatgtggttcataatattgaccacatacatcattaat 25378350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 26660675 - 26660737
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||||||| ||||||||| ||||||| |||||    
26660675 tttttaggttcattcaattaatgatgtatgtggttcataatatggaccacatacatctttaat 26660737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 33738272 - 33738210
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||| ||| ||||||||| |||||||||||||    
33738272 tttttaggttcattcaattaatgatgtatgtggtttataatatggaccacatacatcattaat 33738210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 34038029 - 34037967
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||||||||||| ||||| ||||||| |||||    
34038029 tttttaggttcattcaattaatgatgtatgtggttcatattatagaccacatacatcgttaat 34037967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 34062052 - 34061990
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||||||||| | ||||| |||||||||||||    
34062052 tttttaggttcattcaattaatgatgtatgtggttcatattgttgaccacatacatcattaat 34061990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 37255235 - 37255173
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||| ||| ||||||||| |||||||||||||    
37255235 tttttaggttcattcaattaatgatgtatgtggttaataatatggaccacatacatcattaat 37255173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 39015672 - 39015610
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||||||| ||| ||||| |||||||||||||    
39015672 tttttaggttcattcaattaatgatgtatgtggttcataatattgaccacatacatcattaat 39015610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 238 - 275
Target Start/End: Original strand, 26452737 - 26452774
Alignment:
238 tgacactccaacttttaatctcaacttgtgatttggaa 275  Q
    ||||||||||||||||||||||||||||||||||||||    
26452737 tgacactccaacttttaatctcaacttgtgatttggaa 26452774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 35838827 - 35838766
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||| |   |||||| ||||||||||||||||||||||| ||||||||||||    
35838827 tttttaggttcatttatttaatgatgtatgtggttcatattatggaccacatacatcattaa 35838766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 590 - 650
Target Start/End: Original strand, 5852719 - 5852779
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcatta 650  Q
    |||||||||||||||||  |||||| ||||||||| ||| ||||||||| |||||||||||    
5852719 tttttaggttcattcaattaatgatgtatgtggtttataatatggaccacatacatcatta 5852779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 590 - 650
Target Start/End: Complemental strand, 6763443 - 6763383
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcatta 650  Q
    |||||||||||||||||  |||||| ||||||||| ||| ||||||||| |||||||||||    
6763443 tttttaggttcattcaattaatgatgtatgtggtttataatatggaccaaatacatcatta 6763383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 590 - 650
Target Start/End: Complemental strand, 46518054 - 46517994
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcatta 650  Q
    |||||||||||||||||  |||||| ||||||||| ||| ||||||||| |||||||||||    
46518054 tttttaggttcattcaattaatgatgtatgtggtttataatatggaccacatacatcatta 46517994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 589 - 652
Target Start/End: Complemental strand, 25378367 - 25378304
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||||  |||||| ||||||||  |||||||| |||| |||||||||||||    
25378367 ttttttaggttcattcaattaatgatgtatgtggtcaatattatgaaccacatacatcattaat 25378304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 589 - 652
Target Start/End: Complemental strand, 31909859 - 31909796
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||||  |||||| ||||||||| ||| ||| ||||| |||||||||||||    
31909859 ttttttaggttcattcaattaatgatgtatgtggtttataatatagaccacatacatcattaat 31909796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 38824321 - 38824384
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| ||||||||||  |||||| ||||||||||||| ||| ||||| |||||||||||||    
38824321 ttttttatgttcattcaattaatgatgtatgtggttcataatatagaccacatacatcattaat 38824384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 52879914 - 52879977
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||| |||||||||  |||||| |||||||  |||||||||||||| |||||||||||||    
52879914 ttttttagattcattcaattaatgatgtatgtggaccatattatggaccacatacatcattaat 52879977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 4682968 - 4683030
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| || ||||||  |||||| ||||||||||||||||| ||||| |||||||||||||    
4682968 tttttagatttattcaattaatgatgtatgtggttcatattatagaccacatacatcattaat 4683030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 4974154 - 4974092
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| ||||||||   |||||| ||||||||||||| ||||||||| |||||||||||||    
4974154 tttttagattcattcatttaatgatgtatgtggttcataatatggaccacatacatcattaat 4974092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 5852797 - 5852735
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||| |||||||| |||||| |||||||| ||||||||  |||| |||||||||||||    
5852797 tttttaggtacattcaactaatgatgtatgtggtccatattataaaccacatacatcattaat 5852735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 26059228 - 26059166
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||| ||||||||||  |||||| |||||||| ||||||||  ||||||||||||||||||    
26059228 tttttaagttcattcaattaatgatttatgtggtccatattataaaccatatacatcattaat 26059166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 27549076 - 27549138
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||| ||||||||||  |||||| |||||||| ||||||||| |||| |||||||||||||    
27549076 tttttaagttcattcaattaatgatgtatgtggtccatattatgaaccacatacatcattaat 27549138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 591 - 649
Target Start/End: Complemental strand, 29070725 - 29070667
Alignment:
591 ttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcatt 649  Q
    ||||||||||||||||  |||||| |||||||| |||||||| ||||| ||||||||||    
29070725 ttttaggttcattcaataaatgatgtatgtggtccatattatagaccacatacatcatt 29070667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 589 - 651
Target Start/End: Complemental strand, 31919950 - 31919888
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||||||   |||||| |||||||| ||||||||| |||| ||||||||||||    
31919950 ttttttaggttcattcatttaatgatgtatgtggtccatattatgaaccacatacatcattaa 31919888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 591 - 649
Target Start/End: Complemental strand, 38190956 - 38190898
Alignment:
591 ttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcatt 649  Q
    |||||||||||||||| ||||||| ||||||||| ||| |||  |||||||||||||||    
38190956 ttttaggttcattcaatcaatgatgtatgtggtttataatattaaccatatacatcatt 38190898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 39015594 - 39015656
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||  |||||||| |||| |||||||||||||    
39015594 tttttaggttcattcaattaatgatgtatgtggtcaatattatgaaccacatacatcattaat 39015656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 40907288 - 40907226
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||| |||||| |||||| | |||| |||| |||| |||||||||||||    
40907288 tttttaggttcattcaactaatgatgtatgtgatccataatatgaaccacatacatcattaat 40907226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 589 - 651
Target Start/End: Complemental strand, 41621400 - 41621338
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||||||   ||| |||||||||||||||| |||||| || ||||||||||||    
41621400 ttttttaggttcattcatttaattatatatgtggttcataatatggatcagatacatcattaa 41621338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 45239022 - 45239084
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| |||||| || ||||||| ||||||||||||| ||| ||||| |||||||||||||    
45239022 tttttagattcatttaatcaatgatgtatgtggttcataatatagaccacatacatcattaat 45239084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 46517976 - 46518038
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||| |||||||| |||||| |||||||| ||||||||  |||| |||||||||||||    
46517976 tttttaggtacattcaactaatgatgtatgtggtccatattataaaccacatacatcattaat 46518038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 47011275 - 47011337
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  ||||||||||||||| ||||||||  | || |||||||||||||    
47011275 tttttaggttcattcaattaatgatatatgtggtccatattataaatcacatacatcattaat 47011337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 611 - 652
Target Start/End: Original strand, 7230111 - 7230152
Alignment:
611 tgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||| ||||||||||||||||||||||| |||||||||||||    
7230111 tgatgtatgtggttcatattatggaccacatacatcattaat 7230152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 15998242 - 15998303
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||| ||||||||   |||||| |||||||| ||||||||| |||||||||||||||||    
15998242 tttttagattcattcatttaatgatgtatgtggtacatattatgaaccatatacatcattaa 15998303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 31481896 - 31481957
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||||||||||||| |||||||| | || ||||||||||||    
31481896 tttttaggttcattcatttaatgatatatgtggtttatattatgaatcacatacatcattaa 31481957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 594 - 651
Target Start/End: Original strand, 31919875 - 31919932
Alignment:
594 taggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||   |||||| ||||||||||||| ||||||||| ||||||||||||    
31919875 taggttcattcatttaatgatgtatgtggttcataatatggaccacatacatcattaa 31919932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 34120945 - 34121006
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||| |   |||||| ||||||||||||| ||||||||| ||||||||||||    
34120945 tttttaggttcatttatttaatgatgtatgtggttcataatatggaccacatacatcattaa 34121006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 591 - 652
Target Start/End: Original strand, 34598894 - 34598955
Alignment:
591 ttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||| |||||||||  |||||| ||||||||||||| |||| | ||||||||||||||||    
34598894 ttttagattcattcaaataatgatgtatgtggttcataatatgaatcatatacatcattaat 34598955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 42761264 - 42761325
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||||||||||| ||| ||||| ||||||||||||    
42761264 tttttaggttcattcatttaatgatgtatgtggttcataatatagaccacatacatcattaa 42761325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 591 - 652
Target Start/End: Complemental strand, 43384591 - 43384530
Alignment:
591 ttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||| ||||||||| |||| || ||||||||| ||||||| ||||| |||||||||||||    
43384591 ttttagattcattcaatcaattatgtatgtggtttatattatagaccacatacatcattaat 43384530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 45925353 - 45925292
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||||||||||| ||| ||||| ||||||||||||    
45925353 tttttaggttcattcatttaatgatgtatgtggttcataatatagaccacatacatcattaa 45925292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 47912603 - 47912664
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||||||| ||| ||||||||| ||||||||||||    
47912603 tttttaggttcattcatttaatgatgtatgtggttaataatatggaccacatacatcattaa 47912664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 609 - 653
Target Start/End: Complemental strand, 4798974 - 4798930
Alignment:
609 aatgatatatgtggttcatattatggaccatatacatcattaata 653  Q
    |||||| ||||||||||||| ||||||||| ||||||||||||||    
4798974 aatgatgtatgtggttcataatatggaccacatacatcattaata 4798930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 590 - 650
Target Start/End: Original strand, 26040411 - 26040471
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcatta 650  Q
    ||||||||||||||||   |||||| ||||||||||||| ||||||| | |||||||||||    
26040411 tttttaggttcattcatttaatgatgtatgtggttcataatatggactacatacatcatta 26040471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 590 - 654
Target Start/End: Complemental strand, 28237181 - 28237117
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaataa 654  Q
    |||||||||||||||||  |||||| |||||||| |||| ||||  ||| |||||||||||||||    
28237181 tttttaggttcattcaattaatgatgtatgtggtccataatatgacccacatacatcattaataa 28237117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 590 - 650
Target Start/End: Original strand, 40907210 - 40907270
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcatta 650  Q
    |||||| ||||||| ||  |||||| |||||||||||||||||||| || |||||||||||    
40907210 tttttacgttcatttaattaatgatgtatgtggttcatattatggatcacatacatcatta 40907270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 589 - 649
Target Start/End: Original strand, 49586277 - 49586337
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcatt 649  Q
    ||||||||||||||| ||  ||| || ||| ||||||||||||| ||||||||||||||||    
49586277 ttttttaggttcatttaataaattatgtatatggttcatattatagaccatatacatcatt 49586337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 589 - 652
Target Start/End: Complemental strand, 1252241 - 1252178
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||||  |||||| || ||||| |||| |||| |||| |||||||||||||    
1252241 ttttttaggttcattcaattaatgatgtacgtggtccataatatgaaccacatacatcattaat 1252178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 589 - 652
Target Start/End: Complemental strand, 6169920 - 6169857
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| ||||||||||  |||||| ||||||||| ||||||| ||| | |||||||||||||    
6169920 ttttttaagttcattcaattaatgatgtatgtggttaatattattgactacatacatcattaat 6169857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 8751462 - 8751525
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||||  |||||| ||||||||| || ||||  |||| |||||||||||||    
8751462 ttttttaggttcattcaattaatgatgtatgtggtttatgttataaaccacatacatcattaat 8751525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 589 - 652
Target Start/End: Complemental strand, 12062304 - 12062241
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||| ||  |||||| |||||||| ||||||||| |||| ||| |||||||||    
12062304 ttttttaggttcattgaattaatgatgtatgtggtccatattatgaaccacatatatcattaat 12062241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 589 - 652
Target Start/End: Complemental strand, 17310528 - 17310465
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||| |||||||||||||  |||||||||| || ||  |||||| |||||||||||||||||||    
17310528 ttttgtaggttcattcaattaatgatatatatgatttgtattatagaccatatacatcattaat 17310465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 588 - 651
Target Start/End: Complemental strand, 17387761 - 17387698
Alignment:
588 cttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||| |||||||   |||||| ||||||||| ||| ||||||||| ||||||||||||    
17387761 cttttttaggctcattcatttaatgatgtatgtggtttataatatggaccacatacatcattaa 17387698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 24478695 - 24478758
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||| ||||||||||||  |||||||||||||||  |||||||  |||| |||||||||||||    
24478695 tttttgaggttcattcaattaatgatatatgtggtctatattataaaccacatacatcattaat 24478758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 609 - 652
Target Start/End: Original strand, 28237122 - 28237165
Alignment:
609 aatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||| ||||||| ||||||||||||||| |||||||||||||    
28237122 aatgatgtatgtgggtcatattatggaccacatacatcattaat 28237165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 42140439 - 42140379
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||| ||||||  |||||| ||||||||  ||||||| |||||||||||||||||||    
42140439 tttttaggtttattcaattaatgatgtatgtggt--atattatagaccatatacatcattaat 42140379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 51138888 - 51138951
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||| || ||||||  |||||| ||||||||||||||||||||||| | | |||||||||    
51138888 ttttttagttttattcaattaatgatgtatgtggttcatattatggaccacaaatatcattaat 51138951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 3160781 - 3160843
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| |||||||  |||||||||||||| || || |||||||    
3160781 tttttaggttcattcaattaatgatgtatgtggaccatattatggaccacatgcaccattaat 3160843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 6763365 - 6763427
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||| |||||||| |||||| ||| |||| ||||||||  |||| |||||||||||||    
6763365 tttttaggtacattcaactaatgatgtatttggtccatattataaaccacatacatcattaat 6763427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 12447485 - 12447547
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||  ||||||  |||||| | |||||||||||||||||| || |||||||||||||    
12447485 tttttaggtgtattcaattaatgatgtttgtggttcatattatggatcacatacatcattaat 12447547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 21909872 - 21909934
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||| ||||||  |||||| |||||||| ||||||||| || | |||||||||||||    
21909872 tttttaggtttattcaattaatgatgtatgtggtccatattatgaactacatacatcattaat 21909934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 21909950 - 21909888
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| || ||||||  |||||| ||||| ||||||| ||||||||| |||||||||||||    
21909950 tttttagatttattcaattaatgatgtatgtagttcataatatggaccacatacatcattaat 21909888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 589 - 651
Target Start/End: Complemental strand, 24286875 - 24286813
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||| |||||   |||||||||||||||||||| ||||||||  ||| ||||||||    
24286875 ttttttaggtttattcatttaatgatatatgtggttcataatatggaccgcatatatcattaa 24286813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 26660753 - 26660691
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||| ||  || ||| |||||||| ||||||||| |||| |||||||||||||    
26660753 tttttaggttcattgaattaaagatgtatgtggtccatattatgaaccacatacatcattaat 26660691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 27552339 - 27552277
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| |||| | |||||| ||||||||| |||| ||||||||    
27552339 tttttaggttcattcaattaatgatgtatgagtttcataatatggaccacatacgtcattaat 27552277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 31909780 - 31909842
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||  |||||||  |||| |||||||||||||    
31909780 tttttaggttcattcaattaatgatgtatgtggtctatattataaaccacatacatcattaat 31909842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 37255157 - 37255219
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| |||||||||  |||||| |||||||| ||||||||  |||| |||||||||||||    
37255157 tttttagattcattcaattaatgatgtatgtggtccatattattaaccacatacatcattaat 37255219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 591 - 645
Target Start/End: Original strand, 40960771 - 40960825
Alignment:
591 ttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacat 645  Q
    |||||||||||||||| ||||||||||| ||||| ||||||| || || ||||||    
40960771 ttttaggttcattcaatcaatgatatatatggtttatattatagatcaaatacat 40960825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 589 - 651
Target Start/End: Complemental strand, 42788438 - 42788376
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||| ||||||||   |||||| ||||||||||||| |||||| || ||||||||||||    
42788438 ttttttagattcattcatttaatgatgtatgtggttcataatatggatcacatacatcattaa 42788376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 609 - 651
Target Start/End: Complemental strand, 42914626 - 42914584
Alignment:
609 aatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||| ||||||||||||| |||||| |||||||||||||||    
42914626 aatgatgtatgtggttcataatatggatcatatacatcattaa 42914584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 47011353 - 47011291
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| |||||| || ||| ||||||||| ||| |||||||||    
47011353 tttttaggttcattcaattaatgatgtatgtgatttataatatggaccacatatatcattaat 47011291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 48605101 - 48605163
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| |||||||| |||| |||| | || |||||||||||||    
48605101 tttttaggttcattcaattaatgatgtatgtggtccataatatgaatcacatacatcattaat 48605163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 51138967 - 51138905
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||| ||||||||||  |||||||| |||||| |||| |||| |||| |||||||||||||    
51138967 tttttatgttcattcaattaatgatatttgtggtccataatatgaaccacatacatcattaat 51138905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 435237 - 435298
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||| ||||||||   |||||| ||||||||| ||| ||||||||| ||||||||||||    
435237 tttttagattcattcatttaatgatgtatgtggtttataatatggaccacatacatcattaa 435298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 435315 - 435254
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| |||||||| ||||||||  |||| ||||||||||||    
435315 tttttaggttcattcatttaatgatgtatgtggtccatattataaaccacatacatcattaa 435254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 610 - 651
Target Start/End: Original strand, 9135569 - 9135610
Alignment:
610 atgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||| |||||||||||||||||| |||| ||||||||||||    
9135569 atgatgtatgtggttcatattatgaaccacatacatcattaa 9135610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 9947863 - 9947802
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||| ||||||||   |||||| ||||||||||||| |||||||  |||||||||||||    
9947863 tttttagattcattcatttaatgatgtatgtggttcataatatggactgtatacatcattaa 9947802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 647
Target Start/End: Complemental strand, 13911387 - 13911330
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatca 647  Q
    ||||||||||||||||   |||||| |||||||| ||||||||| |||| ||||||||    
13911387 tttttaggttcattcatttaatgatgtatgtggtccatattatgaaccacatacatca 13911330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 15278674 - 15278613
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||||||  |||||| ||||||||| ||| ||| || || ||||||||||||    
15278674 tttttaggttcattcaattaatgatgtatgtggtttataatatagatcacatacatcattaa 15278613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 15311581 - 15311520
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||| ||| ||| ||||||||| ||||||||||||    
15311581 tttttaggttcattcatttaatgatgtatgtagtttataatatggaccacatacatcattaa 15311520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 15998320 - 15998259
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||| ||||||||| |||| |||| ||||||||||||    
15998320 tttttaggttcattcatttaatgatgtatatggttcataatatgtaccacatacatcattaa 15998259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 17387681 - 17387742
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| |||||||| ||||||||  |||| ||||||||||||    
17387681 tttttaggttcattcatttaatgatgtatgtggtccatattataaaccacatacatcattaa 17387742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 18023722 - 18023661
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||||||||||| |||  ||||||||||| |||||    
18023722 tttttaggttcattcatttaatgatgtatgtggttcataatataaaccatatacattattaa 18023661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 22954803 - 22954864
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||| |||||||||   |||||| ||||||||| ||| ||||||||| ||||||||||||    
22954803 tttttaagttcattcatttaatgatgtatgtggtttataatatggaccacatacatcattaa 22954864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 22954881 - 22954820
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| |||||||| ||||||||  |||| ||||||||||||    
22954881 tttttaggttcattcatttaatgatgtatgtggtccatattataaaccacatacatcattaa 22954820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 24015117 - 24015056
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||| |||||   |||||| ||||||||||||| |||| |||| ||||||||||||    
24015117 tttttaggtttattcatttaatgatgtatgtggttcataatatgaaccacatacatcattaa 24015056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 24286796 - 24286857
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   ||||||||||| ||| ||||||||| |||| ||| ||||||||    
24286796 tttttaggttcattcatttaatgatatatgcggtccatattatgaaccacatatatcattaa 24286857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 597 - 654
Target Start/End: Original strand, 25267892 - 25267949
Alignment:
597 gttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaataa 654  Q
    ||||||||||  ||||||| |||||||||||||||| |  | ||||||||||||||||    
25267892 gttcattcaattaatgatacatgtggttcatattatagttcctatacatcattaataa 25267949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 26040489 - 26040428
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||| || ||||||||| |||| ||||||||||||    
26040489 tttttaggttcattcatataatgatgtatgtagtccatattatgaaccacatacatcattaa 26040428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 26856082 - 26856021
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||| |   |||||| ||||||||||||| ||||||||| |||||| |||||    
26856082 tttttaggttcatttatttaatgatgtatgtggttcataatatggaccacatacattattaa 26856021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 31327598 - 31327659
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||| ||||||||| ||| ||||| ||||||||||||    
31327598 tttttaggttcattcatttaatgatgtatatggttcataatatagaccacatacatcattaa 31327659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 594 - 651
Target Start/End: Complemental strand, 31327672 - 31327615
Alignment:
594 taggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||   |||||| ||||||||  |||||||| |||||||||||||||||    
31327672 taggttcattcatttaatgatgtatgtggtctatattatgaaccatatacatcattaa 31327615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 34662436 - 34662497
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| |||||| || |||||||| |||| ||||||||||||    
34662436 tttttaggttcattcatttaatgatgtatgtgatttatattatgaaccacatacatcattaa 34662497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 37215203 - 37215264
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||| ||||||||   |||||| ||||||||||||| |||||| || ||||||||||||    
37215203 tttttagattcattcatttaatgatgtatgtggttcataatatggatcacatacatcattaa 37215264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 591 - 652
Target Start/End: Complemental strand, 38824399 - 38824338
Alignment:
591 ttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||| |||||||||  |||||| ||||||||  |||||||| |||| |||||||||||||    
38824399 ttttagattcattcaattaatgatgtatgtggtctatattatgaaccacatacatcattaat 38824338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 38847411 - 38847350
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||||||| ||| ||| ||||| ||||||||||||    
38847411 tttttaggttcattcatttaatgatgtatgtggtttataatatagaccacatacatcattaa 38847350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 39181080 - 39181144
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttc--atattatggaccatatacatcattaat 652  Q
    ||||||| |||||||||  |||||| ||||||||||  |||||||| |||| |||||||||||||    
39181080 tttttagattcattcaattaatgatgtatgtggttcatatattatgaaccacatacatcattaat 39181144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 39181160 - 39181096
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcata--ttatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| |||||||||||||   |||| |||| |||||||||||||    
39181160 tttttaggttcattcaattaatgatgtatgtggttcataatatatgaaccacatacatcattaat 39181096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 41649641 - 41649580
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||||    |||||| ||||||||||||| ||||||||| |||||| |||||    
41649641 tttttaggttcattcgtttaatgatgtatgtggttcataatatggaccacatacataattaa 41649580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 47912681 - 47912620
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| |||||||| ||||||||  |||| ||||||||||||    
47912681 tttttaggttcattcatttaatgatgtatgtggtccatattattaaccacatacatcattaa 47912620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 157; Significance: 5e-83; HSPs: 60)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 157; E-Value: 5e-83
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 5752010 - 5751851
Alignment:
1 agtgttccttcnagtctggagaacctttccaatttgcaaactcttgacattatatctctcctataataagttgagtgtgccaattccaaatacagttggc 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5752010 agtgttccttctagtctggagaacctttccaatttgcaaactcttgacattatatctctcctataataagttgagtgtgccaattccaaatacagttggc 5751911  T
101 catctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgtcattaat 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5751910 catctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgtcattaat 5751851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 152 - 240
Target Start/End: Complemental strand, 5752570 - 5752482
Alignment:
152 gtcattaattatccttccctactactccataataataggcctactaatcgatcccactaataaatcttttcatacacatctattattga 240  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5752570 gtcattaattatccttccctactactccataataataggcctactaatcgatcccactaataaatcttttcatacacatctattattga 5752482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 53 - 160
Target Start/End: Original strand, 5852466 - 5852573
Alignment:
53 tatctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtg 152  Q
    ||||| ||| ||||| | ||||||| |||||||||| ||||| ||||||| |||| |||||||| ||  ||||||||||| |||||||||||||  ||||    
5852466 tatctatcccataatcatttgagtgggccaattccacatacaattggccaactttctggtcttcgaagtttgtttctctcttcaaataagttgattggtg 5852565  T
153 tcattaat 160  Q
    ||||||||    
5852566 tcattaat 5852573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 32786147 - 32786209
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||||||||||||||||| |||||||||||||    
32786147 tttttaggttcattcaattaatgatgtatgtggttcatattatggaccacatacatcattaat 32786209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 3343886 - 3343824
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  | |||| ||||||||||||||||||||||| |||||||||||||    
3343886 tttttaggttcattcaattattgatgtatgtggttcatattatggaccacatacatcattaat 3343824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 3418865 - 3418803
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  ||| || |||||||||||||||||| ||||||||||||||||||    
3418865 tttttaggttcattcaattaataatgtatgtggttcatattatgaaccatatacatcattaat 3418803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 589 - 651
Target Start/End: Complemental strand, 29318158 - 29318096
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||||  ||| || ||||||||||||||||||||||| ||||||||||||    
29318158 ttttttaggttcattcaattaataatgtatgtggttcatattatggaccacatacatcattaa 29318096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5763640 - 5763744
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5763640 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5763739  T
154 catta 158  Q
    |||||    
5763740 catta 5763744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5767175 - 5767279
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5767175 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5767274  T
154 catta 158  Q
    |||||    
5767275 catta 5767279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5770710 - 5770814
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5770710 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5770809  T
154 catta 158  Q
    |||||    
5770810 catta 5770814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5774245 - 5774349
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5774245 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5774344  T
154 catta 158  Q
    |||||    
5774345 catta 5774349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5777780 - 5777884
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5777780 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5777879  T
154 catta 158  Q
    |||||    
5777880 catta 5777884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5781315 - 5781419
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5781315 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5781414  T
154 catta 158  Q
    |||||    
5781415 catta 5781419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5784850 - 5784954
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5784850 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5784949  T
154 catta 158  Q
    |||||    
5784950 catta 5784954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5788385 - 5788489
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5788385 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5788484  T
154 catta 158  Q
    |||||    
5788485 catta 5788489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5791920 - 5792024
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5791920 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5792019  T
154 catta 158  Q
    |||||    
5792020 catta 5792024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5795455 - 5795559
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5795455 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5795554  T
154 catta 158  Q
    |||||    
5795555 catta 5795559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5798990 - 5799094
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5798990 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5799089  T
154 catta 158  Q
    |||||    
5799090 catta 5799094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5802525 - 5802629
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5802525 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5802624  T
154 catta 158  Q
    |||||    
5802625 catta 5802629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5806060 - 5806164
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5806060 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5806159  T
154 catta 158  Q
    |||||    
5806160 catta 5806164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5809595 - 5809699
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5809595 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5809694  T
154 catta 158  Q
    |||||    
5809695 catta 5809699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5813130 - 5813234
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5813130 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5813229  T
154 catta 158  Q
    |||||    
5813230 catta 5813234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5816665 - 5816769
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5816665 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5816764  T
154 catta 158  Q
    |||||    
5816765 catta 5816769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 158
Target Start/End: Original strand, 5820200 - 5820304
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||||||| ||||| ||||||||| | || ||||| ||||  ||||||| |||| |  ||||||| | ||||||||||||||||||||||| ||| ||||    
5820200 atctctcccataatgagttgagtgggtcatttccacatacgattggccaactttcttatcttcaagaattgtttctctcatcaaataagtttaacagtgt 5820299  T
154 catta 158  Q
    |||||    
5820300 catta 5820304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 667758 - 667821
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||| |  |||||| ||||| ||||||||||||||||| |||||||||||||    
667758 ttttttaggttcattccattaatgatgtatgtagttcatattatggaccacatacatcattaat 667821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 57 - 160
Target Start/End: Original strand, 5879906 - 5880009
Alignment:
57 tctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgtcat 156  Q
    ||||| ||||| ||||||| | |||  ||||| ||||| ||||||| |||||||||||  || ||||   |||||| |||||||||||||||||||||||    
5879906 tctcccataatcagttgagcgggccgtttccacatacaattggccaactttttggtctaaaagagttacatctctcttcaaataagttgaacggtgtcat 5880005  T
157 taat 160  Q
    ||||    
5880006 taat 5880009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 590 - 649
Target Start/End: Complemental strand, 9908245 - 9908186
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcatt 649  Q
    |||||||||||||||||  |||||| |||||| |||||||||||||||| ||||||||||    
9908245 tttttaggttcattcaattaatgatgtatgtgattcatattatggaccacatacatcatt 9908186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 3212272 - 3212334
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| |||||| || ||||||||||||| |||||||||||||    
3212272 tttttaggttcattcaattaatgatgtatgtgatttatattatggaccacatacatcattaat 3212334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 54 - 160
Target Start/End: Original strand, 5829523 - 5829629
Alignment:
54 atctctcctataataagttgagtgtgccaattccaaatacagttggccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgt 153  Q
    |||| ||| ||||| | ||||||| | |||||||| ||||| ||||||| |||| | |||||  ||||||| ||||||| |||||||| |||| ||||||    
5829523 atctttcccataatcatttgagtgggtcaattccacatacaattggccaactttctagtcttgcaaagttgcttctctcttcaaataaattgagcggtgt 5829622  T
154 cattaat 160  Q
    |||||||    
5829623 cattaat 5829629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 7418906 - 7418968
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||||||| ||| ||||| |||||||||||||    
7418906 tttttaggttcattcaattaatgatgtatgtggttcataatatagaccacatacatcattaat 7418968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 21478584 - 21478646
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| |||||||||  |||||| ||||||||||||||||| ||||| |||||||||||||    
21478584 tttttagattcattcaattaatgatgtatgtggttcatattatagaccacatacatcattaat 21478646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 589 - 651
Target Start/End: Complemental strand, 32710182 - 32710120
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||||||   ||||||||||||||||||||||||| |||| |||||| |||||    
32710182 ttttttaggttcattcatttaatgatatatgtggttcatattatgaaccacatacattattaa 32710120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 12290976 - 12291037
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||||||||||| ||||||||| ||||||||||||    
12290976 tttttaggttcattcacttaatgatgtatgtggttcataatatggaccacatacatcattaa 12291037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 14897078 - 14897139
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||||||||||| ||||||||| ||||||||||||    
14897078 tttttaggttcattcatttaatgatgtatgtggttcataatatggaccacatacatcattaa 14897139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 26597196 - 26597257
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||||||||||| ||||||||| ||||||||||||    
26597196 tttttaggttcattcatttaatgatgtatgtggttcataatatggaccacatacatcattaa 26597257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 28034046 - 28034107
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||||||||||| ||||||||| ||||||||||||    
28034046 tttttaggttcattcatttaatgatgtatgtggttcataatatggaccacatacatcattaa 28034107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 5433440 - 5433378
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||| ||||||||||  |||||| |||| |||||||||| ||||||| |||||||||||||    
5433440 tttttatgttcattcaattaatgatgtatgcggttcatattgtggaccacatacatcattaat 5433378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 6048065 - 6048003
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| |||||||||  |||||| |||||||||||||||||||  || |||||||||||||    
6048065 tttttagattcattcaattaatgatgtatgtggttcatattatgggtcacatacatcattaat 6048003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 9908167 - 9908229
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||| ||||||| |||||||| |||| |||| | || |||||||||||||    
9908167 tttttaggttcattcaatcaatgatgtatgtggtccataatatgaatcacatacatcattaat 9908229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 609 - 651
Target Start/End: Complemental strand, 10118708 - 10118666
Alignment:
609 aatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||| ||||||||||||||||||||||| ||||||||||||    
10118708 aatgatgtatgtggttcatattatggaccacatacatcattaa 10118666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 26498624 - 26498686
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||| |||||  |||||| ||| ||||||||||||| ||||| |||||||||||||    
26498624 tttttaggttccttcaattaatgatgtatatggttcatattatagaccacatacatcattaat 26498686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 589 - 651
Target Start/End: Complemental strand, 29938460 - 29938398
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||| |||||   |||||| ||||| ||||||||||||||||| ||||||||||||    
29938460 ttttttaggtttattcatttaatgatgtatgtagttcatattatggaccacatacatcattaa 29938398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 32786225 - 32786163
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| |||||||| |||| |||| |||| |||||||||||||    
32786225 tttttaggttcattcaattaatgatgtatgtggtccataatatgaaccacatacatcattaat 32786163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 2693693 - 2693754
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||| |   |||||| ||||||||||||| ||||||||| ||||||||||||    
2693693 tttttaggttcatttatttaatgatgtatgtggttcataatatggaccacatacatcattaa 2693754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 2693771 - 2693710
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| |||||||| ||||||||| |||| ||||||||||||    
2693771 tttttaggttcattcatttaatgatgtatgtggtccatattatgaaccacatacatcattaa 2693710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 25371035 - 25371096
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||| |||||||||   |||||| ||||||||||||| ||||||||| ||||||||||||    
25371035 tttttaagttcattcatttaatgatgtatgtggttcataatatggaccacatacatcattaa 25371096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 25371113 - 25371052
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| |||||||| ||||||||| |||| ||||||||||||    
25371113 tttttaggttcattcatttaatgatgtatgtggtccatattatgaaccacatacatcattaa 25371052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 26597274 - 26597213
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| |||||||| ||||||||| |||| ||||||||||||    
26597274 tttttaggttcattcatttaatgatgtatgtggtccatattatgaaccacatacatcattaa 26597213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 28034124 - 28034063
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| |||||||| ||||||||| |||| ||||||||||||    
28034124 tttttaggttcattcatttaatgatgtatgtggtccatattatgaaccacatacatcattaa 28034063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 3343807 - 3343870
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||||  |||||| |||||||| |||| |||| |||| |||||||| ||||    
3343807 ttttttaggttcattcaattaatgatgtatgtggtccataatatgaaccacatacatcaataat 3343870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 590 - 649
Target Start/End: Complemental strand, 30507108 - 30507049
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcatt 649  Q
    ||||||||||||||||   |||||| ||||||||||||| ||| ||||| ||||||||||    
30507108 tttttaggttcattcatttaatgatgtatgtggttcataatatagaccacatacatcatt 30507049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 609 - 652
Target Start/End: Original strand, 31759374 - 31759417
Alignment:
609 aatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||| |||| |||||||||||||||||| |||||||||||||    
31759374 aatgatgtatgcggttcatattatggaccacatacatcattaat 31759417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 589 - 652
Target Start/End: Complemental strand, 32161674 - 32161611
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||||  |||||| |||||||  |||||||| ||||| ||||| |||||||    
32161674 ttttttaggttcattcaaataatgatgtatgtggaccatattatagaccacatacaccattaat 32161611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 3418787 - 3418849
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||| ||||||||| |||| |||| |||||| ||||||    
3418787 tttttaggttcattcaattaatgatgtatatggttcataatatgaaccacatacattattaat 3418849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 591 - 652
Target Start/End: Complemental strand, 667836 - 667775
Alignment:
591 ttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||  |||||| |||||||| |||| |||| || | |||||||||||||    
667836 ttttaggttcattcaattaatgatgtatgtggtccataatatgaactacatacatcattaat 667775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 10118649 - 10118710
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| |||||||| |||| |||| |||| ||||||||||||    
10118649 tttttaggttcattcatttaatgatgtatgtggtccataatatgaaccacatacatcattaa 10118710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 10731582 - 10731521
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||||||  |||||| ||||||||| ||| ||| || || ||||||||||||    
10731582 tttttaggttcattcaattaatgatgtatgtggtttataatatagatcacatacatcattaa 10731521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 11213325 - 11213264
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||| || ||||||||| |||| ||||||||||||    
11213325 tttttaggttcattcatttaatgatgtatgtcgtccatattatgaaccacatacatcattaa 11213264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 12588875 - 12588814
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   ||| || |||||| ||||||||||| |||| ||||||||||||    
12588875 tttttaggttcattcatttaataatgtatgtgtttcatattatgaaccacatacatcattaa 12588814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 13902131 - 13902071
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   | |||| ||||||||||||| ||||||||| ||||||||||||    
13902131 tttttaggttcattcatt-attgatgtatgtggttcataatatggaccacatacatcattaa 13902071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0127 (Bit Score: 138; Significance: 1e-71; HSPs: 2)
Name: scaffold0127
Description:

Target: scaffold0127; HSP #1
Raw Score: 138; E-Value: 1e-71
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 17832 - 17992
Alignment:
1 agtgttccttcnagtctggagaacctttccaatttgcaaactcttgacattatatctctcctataataagttgagtgtgccaattccaaataca-gttgg 99  Q
    ||||||||||| ||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
17832 agtgttccttctagtttggggaacctttccaatttccaaactcttgacattatatctctcctataataagttgagtgtgccaattccaaatacaggttgg 17931  T
100 ccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgtcattaat 160  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17932 ccatctttttggtcttcaaaagttgtttctctcatcaaataagttgaacggtgtcattaat 17992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0127; HSP #2
Raw Score: 68; E-Value: 7e-30
Query Start/End: Original strand, 152 - 240
Target Start/End: Original strand, 17434 - 17518
Alignment:
152 gtcattaattatccttccctactactccataataataggcctactaatcgatcccactaataaatcttttcatacacatctattattga 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||| |||||    
17434 gtcattaattatccttccctactactccataataataggcctacta----atcccactaataaatcttttcatacacatctatcattga 17518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 51; Significance: 1e-19; HSPs: 114)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 30162720 - 30162658
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||| |||||||||||||    
30162720 tttttaggttcattcaattaatgatatatgtggttcatattatggaccacatacatcattaat 30162658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 32112344 - 32112407
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||||  |||||| ||||||||||||| ||||||||| |||||||||||||    
32112344 ttttttaggttcattcaattaatgatgtatgtggttcataatatggaccacatacatcattaat 32112407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 590 - 645
Target Start/End: Complemental strand, 34459094 - 34459039
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacat 645  Q
    |||||||||||||||||  ||||||||||||||||||||| |||||||||||||||    
34459094 tttttaggttcattcaattaatgatatatgtggttcatataatggaccatatacat 34459039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 24529604 - 24529666
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||||||||||| ||||| |||||||||||||    
24529604 tttttaggttcattcaattaatgatgtatgtggttcatattatagaccacatacatcattaat 24529666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 44639855 - 44639793
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| |||||||||  |||||| ||||||||||||||||||||||| |||||||||||||    
44639855 tttttagattcattcaattaatgatgtatgtggttcatattatggaccacatacatcattaat 44639793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 4711436 - 4711499
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| ||||||||||  |||||| ||||||||||||||||||||||| |||| ||||||||    
4711436 ttttttatgttcattcaattaatgatttatgtggttcatattatggaccacatacttcattaat 4711499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 589 - 652
Target Start/End: Complemental strand, 41789031 - 41788968
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| ||| ||||||  |||||| ||||||||||||||||||||||| |||||||||||||    
41789031 ttttttaagtttattcaattaatgatgtatgtggttcatattatggaccacatacatcattaat 41788968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 597 - 652
Target Start/End: Complemental strand, 53508602 - 53508547
Alignment:
597 gttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||  |||||| ||||||||||||||||||||||| |||||||||||||    
53508602 gttcattcaattaatgatgtatgtggttcatattatggaccacatacatcattaat 53508547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 597 - 652
Target Start/End: Original strand, 53551633 - 53551688
Alignment:
597 gttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||  |||||| ||||||||||||||||||||||| |||||||||||||    
53551633 gttcattcaattaatgatgtatgtggttcatattatggaccacatacatcattaat 53551688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 589 - 651
Target Start/End: Complemental strand, 171238 - 171176
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||||||   |||||| ||||||||||||| ||||||||| ||||||||||||    
171238 ttttttaggttcattcatttaatgatgtatgtggttcataatatggaccacatacatcattaa 171176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 9968332 - 9968394
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||| ||| ||||||||| |||||||||||||    
9968332 tttttaggttcattcaattaatgatgtatgtggttaataatatggaccacatacatcattaat 9968394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 11583816 - 11583754
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| |||||||||  |||||| ||||| ||||||||||||||||| |||||||||||||    
11583816 tttttagattcattcaattaatgatgtatgtagttcatattatggaccacatacatcattaat 11583754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 13743967 - 13743905
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||| ||| ||||||||| |||||||||||||    
13743967 tttttaggttcattcaattaatgatgtatgtggtttataatatggaccacatacatcattaat 13743905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 17028264 - 17028326
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||||||||| ||| ||| ||||||||| |||||||||||||    
17028264 tttttaggttcattcaattaatgatatatgtagtttataatatggaccacatacatcattaat 17028326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 17659574 - 17659512
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| |||||||||  |||||||||||||||||| | ||||||||| |||||||||||||    
17659574 tttttagattcattcaattaatgatatatgtggttcaaaatatggaccacatacatcattaat 17659512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 26206625 - 26206687
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| || ||||||  |||||||||||||||||||| ||||||||| |||||||||||||    
26206625 tttttagatttattcaattaatgatatatgtggttcataatatggaccacatacatcattaat 26206687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 598 - 652
Target Start/End: Complemental strand, 33084818 - 33084764
Alignment:
598 ttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||  |||||||||| ||||||||||||||||||| |||||||||||||    
33084818 ttcattcaattaatgatatatctggttcatattatggaccacatacatcattaat 33084764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 589 - 651
Target Start/End: Complemental strand, 40545406 - 40545344
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||||||   ||||||||||||||| ||||||||| |||| ||||||||||||    
40545406 ttttttaggttcattcacttaatgatatatgtggtccatattatgaaccaaatacatcattaa 40545344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 48042700 - 48042638
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||| ||||||||||| ||||| |||||||||||||    
48042700 tttttaggttcattcaattaatgatgtatgtagttcatattatagaccacatacatcattaat 48042638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 50519371 - 50519309
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||||||||||| ||||| |||||| ||||||    
50519371 tttttaggttcattcaattaatgatgtatgtggttcatattatagaccacatacataattaat 50519309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 591 - 649
Target Start/End: Original strand, 54787014 - 54787072
Alignment:
591 ttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcatt 649  Q
    |||||||||||||||| ||||||| ||||||||| ||||||| ||||| ||||||||||    
54787014 ttttaggttcattcaatcaatgatgtatgtggtttatattatagaccacatacatcatt 54787072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 7695238 - 7695177
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||||||||||| ||||||||| ||||||||||||    
7695238 tttttaggttcattcatttaatgatgtatgtggttcataatatggaccacatacatcattaa 7695177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 34709684 - 34709623
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||||||||||| ||||||||| ||||||||||||    
34709684 tttttaggttcattcatttaatgatgtatgtggttcataatatggaccacatacatcattaa 34709623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 589 - 650
Target Start/End: Complemental strand, 54569466 - 54569405
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcatta 650  Q
    ||||||||||||||||||  |||||| ||||||||||||||||||||| | || ||||||||    
54569466 ttttttaggttcattcaattaatgatgtatgtggttcatattatggactacatgcatcatta 54569405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 12721676 - 12721739
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatat-tatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| |||||||||||||| |||| |||| |||||||||||||    
12721676 tttttaggttcattcaattaatgatgtatgtggttcatatatatgaaccacatacatcattaat 12721739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 12721755 - 12721692
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatat-tatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| |||||||||||||| |||| |||| |||||||||||||    
12721755 tttttaggttcattcaattaatgatgtatgtggttcatatatatgaaccacatacatcattaat 12721692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 590 - 649
Target Start/End: Original strand, 24156170 - 24156229
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcatt 649  Q
    ||||||||||||||||   |||||| |||||||||||||||||||| || ||||||||||    
24156170 tttttaggttcattcatttaatgatgtatgtggttcatattatggatcacatacatcatt 24156229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 41788951 - 41789014
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||||  |||||| |||||||| |||| |||| |||| |||||||||||||    
41788951 ttttttaggttcattcaattaatgatgtatgtggtccataatatgaaccacatacatcattaat 41789014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 49745493 - 49745556
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| ||||||||||  |||||| ||||||||| ||| ||||||||| |||||||||||||    
49745493 ttttttatgttcattcaattaatgatgtatgtggtttataatatggaccacatacatcattaat 49745556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 16200198 - 16200259
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||   |||||| ||||||||||||| ||||||||| |||||||||||||    
16200198 tttttaggttcattcagttaatgatgtatgtggttcata-tatggaccacatacatcattaat 16200259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 16450268 - 16450206
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||| ||||||||||  |||||||||||||||| |||||||||| || || ||||||||||    
16450268 tttttatgttcattcaattaatgatatatgtggtttatattatggatcacatgcatcattaat 16450206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 19754246 - 19754308
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| |||||||||  ||||||||||||||| ||||||||| || | |||||||||||||    
19754246 tttttagattcattcaattaatgatatatgtggtccatattatgaactacatacatcattaat 19754308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 19785560 - 19785498
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| |||||||||  ||||||||||||||| ||||||||| || | |||||||||||||    
19785560 tttttagattcattcaattaatgatatatgtggtccatattatgaactacatacatcattaat 19785498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 23329401 - 23329463
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||| ||| ||||||||| |||||||| ||||    
23329401 tttttaggttcattcaattaatgatgtatgtggtttataatatggaccacatacatcaataat 23329463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 23710944 - 23710882
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||| ||| ||||||||| |||||||| ||||    
23710944 tttttaggttcattcaattaatgatgtatgtggtttataatatggaccacatacatcaataat 23710882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 23754301 - 23754239
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  ||||||||||||||| | ||||||  |||| |||||||||||||    
23754301 tttttaggttcattcaattaatgatatatgtggtccgtattataaaccacatacatcattaat 23754239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 25856041 - 25856103
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| |||||| || ||||||| ||||||||||||| ||| ||||| |||||||||||||    
25856041 tttttagattcatttaatcaatgatgtatgtggttcataatatagaccacatacatcattaat 25856103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 29978523 - 29978585
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||| ||||||||||||  |||||| |||||||| ||||||||| |||| |||||||||||||    
29978523 ttttaaggttcattcaattaatgatgtatgtggtccatattatgaaccacatacatcattaat 29978585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 598 - 652
Target Start/End: Complemental strand, 29978593 - 29978539
Alignment:
598 ttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||  |||||| ||||||||||||| ||||||||| |||||||||||||    
29978593 ttcattcaattaatgatgtatgtggttcataatatggaccacatacatcattaat 29978539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 30051374 - 30051436
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| || ||||| ||||||||| |||| |||||||||||||    
30051374 tttttaggttcattcaattaatgatgtacgtggtccatattatgaaccacatacatcattaat 30051436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 30279171 - 30279233
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||   |||||| ||||||||||||| ||| ||||| |||||||||||||    
30279171 tttttaggttcattcagttaatgatctatgtggttcataatatagaccacatacatcattaat 30279233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 589 - 651
Target Start/End: Original strand, 42546017 - 42546079
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||  | |||||| |||||||| ||||||||| ||||||||||| |||||    
42546017 ttttttaggttcattcttctaatgatgtatgtggtccatattatgaaccatatacattattaa 42546079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 43635867 - 43635929
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||| |||||||||  |||||| |||||||||||||||||| || | |||||||||||||    
43635867 tttttagattcattcaattaatgatgtatgtggttcatattatgaactacatacatcattaat 43635929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 44639777 - 44639839
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| |||||||| |||| |||| |||| |||||||||||||    
44639777 tttttaggttcattcaattaatgatgtatgtggtccataatatgaaccacatacatcattaat 44639839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 589 - 651
Target Start/End: Original strand, 48796206 - 48796267
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||||||   |||||| ||||||||||||| ||||||||| ||||||||||||    
48796206 ttttttaggttcattcatttaatgatgtatgtggttcata-tatggaccacatacatcattaa 48796267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 51126136 - 51126198
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||  ||||||| ||||| |||||||||||||    
51126136 tttttaggttcattcaattaatgatgtatgtggtctatattatagaccacatacatcattaat 51126198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 55501233 - 55501295
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| ||||||||| |||||||| |||| ||||| |||||||    
55501233 tttttaggttcattcaattaatgatgtatgtggtttatattatgaaccacatacaccattaat 55501295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 171159 - 171220
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| |||||||| ||||||||| |||| ||||||||||||    
171159 tttttaggttcattcatttaatgatgtatgtggtccatattatgaaccacatacatcattaa 171220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 2994752 - 2994813
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||| ||||||| ||||||||| ||||||||||||    
2994752 tttttaggttcattcatttaatgatgtatgtagttcataatatggaccacatacatcattaa 2994813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 8014214 - 8014275
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||||||||||| ||||||||| || |||||||||    
8014214 tttttaggttcattcatttaatgatgtatgtggttcataatatggaccacatgcatcattaa 8014275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 15641332 - 15641271
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||| ||||||| ||| ||||||||||||||||||    
15641332 tttttaggttcattcatttaatgatgtatgtagttcataatatagaccatatacatcattaa 15641271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 18327965 - 18328026
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||| ||||||||| ||||||||| ||||||||||||    
18327965 tttttaggttcattcatttaatgatgtatatggttcataatatggaccacatacatcattaa 18328026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 18437434 - 18437373
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||| ||||||||| ||||||||| ||||||||||||    
18437434 tttttaggttcattcatttaatgatgtatatggttcataatatggaccacatacatcattaa 18437373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 18592454 - 18592393
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||||||||||| |||||| || ||||||||||||    
18592454 tttttaggttcattcatttaatgatgtatgtggttcataatatggatcacatacatcattaa 18592393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 26185899 - 26185960
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||||||  ||||||||| ||||| ||||||||| |||| ||| ||||||||    
26185899 tttttaggttcattcaattaatgatatacgtggtacatattatgaaccacatatatcattaa 26185960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 31808353 - 31808414
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| ||||||||||||| ||| ||||| ||||||||||||    
31808353 tttttaggttcattcatttaatgatgtatgtggttcataatatagaccacatacatcattaa 31808414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 591 - 652
Target Start/End: Complemental strand, 32112422 - 32112361
Alignment:
591 ttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||| ||||||||||  |||||| |||||||| ||||||||| |||| |||||||||||||    
32112422 ttttaagttcattcaattaatgatgtatgtggtccatattatgaaccacatacatcattaat 32112361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Original strand, 45861036 - 45861097
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||||||||||||   |||||| |||||||| ||||||||| |||| ||||||||||||    
45861036 tttttaggttcattcatttaatgatgtatgtggtccatattatgaaccacatacatcattaa 45861097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 45861114 - 45861053
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    ||||||| ||||||||   |||||| ||||||||||||| ||||||||| ||||||||||||    
45861114 tttttagattcattcatttaatgatgtatgtggttcataatatggaccacatacatcattaa 45861053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 590 - 651
Target Start/End: Complemental strand, 54927214 - 54927153
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||| |||||||   |||||| ||||||||||||| ||||||||| ||||||||||||    
54927214 tttttaggatcattcatttaatgatgtatgtggttcataatatggaccacatacatcattaa 54927153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 23754222 - 23754285
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||||  |||||| ||||||||| ||| || |||||| ||| |||||||||    
23754222 ttttttaggttcattcaattaatgatgtatgtggtttataatacggaccacatatatcattaat 23754285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 590 - 649
Target Start/End: Complemental strand, 25856119 - 25856060
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcatt 649  Q
    |||||||||||||||||  |||||| ||||||||  |||||||| |||| ||||||||||    
25856119 tttttaggttcattcaattaatgatgtatgtggtctatattatgaaccacatacatcatt 25856060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 589 - 652
Target Start/End: Original strand, 33659802 - 33659865
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||||||||||  |||||| ||||| ||  |||||||| |||| |||||||||||||    
33659802 ttttttaggttcattcaattaatgatgtatgtagtatatattatgaaccacatacatcattaat 33659865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 589 - 652
Target Start/End: Complemental strand, 42013256 - 42013193
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    ||||||||||| ||||||  |||||| ||||||||| ||| ||| ||||| |||||||||||||    
42013256 ttttttaggtttattcaattaatgatgtatgtggtttataatatagaccacatacatcattaat 42013193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 589 - 651
Target Start/End: Complemental strand, 2994831 - 2994769
Alignment:
589 ttttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaa 651  Q
    |||||||||||||||||   |||||| |||||||| ||||||||| || | ||||||||||||    
2994831 ttttttaggttcattcatttaatgatgtatgtggtccatattatgaactacatacatcattaa 2994769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Complemental strand, 16391783 - 16391721
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||| ||||||  |||| | |||||||||||||||| |||||| ||||||| |||||    
16391783 tttttaggtttattcaattaatgttgtatgtggttcatattacggaccacatacatcgttaat 16391721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 590 - 652
Target Start/End: Original strand, 17659496 - 17659558
Alignment:
590 tttttaggttcattcaaccaatgatatatgtggttcatattatggaccatatacatcattaat 652  Q
    |||||||||||||||||  |||||| |||||||| |||||| || |||| ||| |||||||||    
17659496 tttttaggttcattcaattaatgatgtatgtggtccatattttgaaccacatatatcattaat 17659558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 609 - 651
Target Start/End: Complemental strand, 18328024 - 18327982
Alignment: