View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-16 (Length: 623)

Name: J5-6-16
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-16
J5-6-16
[»] chr4 (2 HSPs)
chr4 (75-623)||(55287668-55288216)
chr4 (1-80)||(55287411-55287490)
[»] chr7 (2 HSPs)
chr7 (25-80)||(2606632-2606687)
chr7 (25-75)||(10294156-10294206)


Alignment Details
Target: chr4 (Bit Score: 469; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 469; E-Value: 0
Query Start/End: Original strand, 75 - 623
Target Start/End: Complemental strand, 55288216 - 55287668
Alignment:
75 attaatacgcaaaacagtagataaaaagtttgcatcctgtacccatgaacaacctgtcaatttcaataacccctttacatcttcnnnnnnnnnnnnnnnn 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                    
55288216 attaatacgcaaaacagtagataaaaagtttgcatcctgtacccatgaacaacctgtcaatttcaataacccctttacatcttcaaaaaaaacaaaaaaa 55288117  T
175 cttcacatatttcatgtggtctatagtacaaaactgcactgcatgccttagacccagcaatagcacagtgtgaataaggggttcaccattaggattttcc 274  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
55288116 cttcacatatttcatgtggtctatagtacaaaactgcactgcatgccttagacccaacaatagcacagtgtgaataaggggttcaccattaggattttcc 55288017  T
275 aaagggacaactacttgctagaaagtgtcaaaaggagaccatagtgatcgctgggcaaaacagggcataccagttgtttgatctcgcctcttactttctt 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55288016 aaagggacaactacttgctagaaagtgtcaaaaggagaccatagtgatcgctgggcaaaacagggcataccagttgtttgatctcgcctcttactttctt 55287917  T
375 ctctttgttatatgaaacaccaggtatttcatccatcccaatcatgtcaatattgtttatcttaaaatcacgtaaacgacaaacaaaacgatccaatcgc 474  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
55287916 ctctttgttatatgaaacaccaggtatttcatccatcccaatcatgtcaatattgcttatcttaaaatcacgtaaacgacaaacaaaacgatccaatcgc 55287817  T
475 ttttggagagtacgattgcctgtcaacatttgggttgacttggtatcatatgtcccaccagcttcatttggtcttagtacagaccaggcatcaagccncc 574  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||    
55287816 ttttggagagtacgattgcctgtcaacatttggtttgacttggtatcatatgtccaaccagcttcatttggtcttagtacagaccaggcatcaagccacc 55287717  T
575 cgtcttgcnaaggatattgaccatccnttttgtcatcccngttcctatc 623  Q
    |||||||| ||||||||||||||||| |||||||||||| |||| ||||    
55287716 cgtcttgcaaaggatattgaccatcctttttgtcatcccagttcatatc 55287668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 55287490 - 55287411
Alignment:
1 aagttctcttcccattatagagttgctaaatgatttggcggagaaagatttcaccggcagtttgcttaactgaaattaat 80  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55287490 aagttctcttcccattatagagttgctaaatgatttggcggagaaagatttcaccggcagtttgcttaactgaaattaat 55287411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 25 - 80
Target Start/End: Original strand, 2606632 - 2606687
Alignment:
25 gctaaatgatttggcggagaaagatttcaccggcagtttgcttaactgaaattaat 80  Q
    ||||||||| |||| ||||||||||||||| || ||||||||||||||||||||||    
2606632 gctaaatgagttggtggagaaagatttcacaggtagtttgcttaactgaaattaat 2606687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 25 - 75
Target Start/End: Complemental strand, 10294206 - 10294156
Alignment:
25 gctaaatgatttggcggagaaagatttcaccggcagtttgcttaactgaaa 75  Q
    ||||||||| ||||||| |||||||||||| || || ||||||||||||||    
10294206 gctaaatgagttggcggggaaagatttcacaggtagattgcttaactgaaa 10294156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106268 times since January 2019
Visitors: 1320