View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-19 (Length: 373)

Name: J5-6-19
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-19
J5-6-19
[»] chr8 (22 HSPs)
chr8 (198-373)||(3174316-3174491)
chr8 (212-285)||(4989884-4989957)
chr8 (1-57)||(3174264-3174320)
chr8 (51-137)||(3174552-3174637)
chr8 (5-57)||(11656111-11656163)
chr8 (5-57)||(16295683-16295735)
chr8 (5-57)||(16303385-16303437)
chr8 (5-57)||(27696577-27696629)
chr8 (5-57)||(37246507-37246559)
chr8 (7-57)||(40953576-40953626)
chr8 (5-57)||(43597179-43597231)
chr8 (206-287)||(26672736-26672817)
chr8 (206-251)||(34714003-34714048)
chr8 (205-253)||(44874313-44874361)
chr8 (206-241)||(26195455-26195490)
chr8 (206-252)||(21016139-21016185)
chr8 (206-285)||(6433492-6433571)
chr8 (206-253)||(10694787-10694834)
chr8 (206-253)||(14855466-14855513)
chr8 (206-252)||(37433247-37433293)
chr8 (212-285)||(11295552-11295625)
chr8 (5-49)||(42180664-42180708)
[»] chr7 (18 HSPs)
chr7 (206-285)||(29687424-29687503)
chr7 (206-288)||(1910189-1910271)
chr7 (206-253)||(24359790-24359837)
chr7 (206-287)||(8292691-8292772)
chr7 (206-253)||(5240414-5240461)
chr7 (206-285)||(7323035-7323114)
chr7 (7-57)||(18502834-18502884)
chr7 (212-252)||(5348057-5348097)
chr7 (206-253)||(8380421-8380468)
chr7 (206-253)||(22521566-22521613)
chr7 (206-253)||(29034667-29034714)
chr7 (211-253)||(49069535-49069577)
chr7 (206-253)||(27053575-27053622)
chr7 (206-241)||(40194818-40194853)
chr7 (206-253)||(42222201-42222248)
chr7 (206-252)||(29959048-29959094)
chr7 (234-287)||(48705577-48705630)
chr7 (6-38)||(6110447-6110479)
[»] chr5 (21 HSPs)
chr5 (206-289)||(16315614-16315697)
chr5 (206-285)||(35653337-35653416)
chr5 (213-287)||(25017380-25017454)
chr5 (211-284)||(39567852-39567925)
chr5 (206-285)||(5151437-5151516)
chr5 (206-288)||(34546723-34546805)
chr5 (206-286)||(8410089-8410169)
chr5 (206-288)||(13951318-13951393)
chr5 (206-285)||(12914123-12914202)
chr5 (206-253)||(28143205-28143252)
chr5 (5-57)||(25346815-25346867)
chr5 (212-287)||(27823207-27823283)
chr5 (5-57)||(29861214-29861266)
chr5 (5-55)||(15921948-15921998)
chr5 (206-286)||(3639156-3639236)
chr5 (206-242)||(4962598-4962634)
chr5 (5-49)||(33007760-33007804)
chr5 (206-253)||(39692990-39693037)
chr5 (206-279)||(4422046-4422119)
chr5 (20-57)||(7883569-7883606)
chr5 (206-242)||(43414146-43414182)
[»] chr4 (30 HSPs)
chr4 (206-286)||(47188747-47188827)
chr4 (206-287)||(45688689-45688770)
chr4 (206-284)||(23765527-23765605)
chr4 (206-285)||(50514695-50514774)
chr4 (206-284)||(30475374-30475452)
chr4 (206-287)||(34316805-34316886)
chr4 (206-287)||(2362575-2362656)
chr4 (206-271)||(33951662-33951727)
chr4 (5-57)||(5787040-5787092)
chr4 (206-285)||(26831868-26831946)
chr4 (206-253)||(35808478-35808525)
chr4 (206-288)||(26040442-26040524)
chr4 (206-286)||(31168081-31168161)
chr4 (206-286)||(41956295-41956375)
chr4 (5-57)||(45498937-45498989)
chr4 (214-285)||(54339061-54339132)
chr4 (206-288)||(19329010-19329087)
chr4 (206-252)||(51266905-51266951)
chr4 (206-272)||(55669700-55669766)
chr4 (5-57)||(34514190-34514242)
chr4 (5-57)||(36198579-36198631)
chr4 (5-57)||(44289390-44289442)
chr4 (206-253)||(10100195-10100242)
chr4 (206-253)||(31754918-31754965)
chr4 (206-265)||(53567035-53567094)
chr4 (5-55)||(34510582-34510632)
chr4 (206-275)||(9693553-9693622)
chr4 (5-57)||(37910427-37910479)
chr4 (206-253)||(20811243-20811290)
chr4 (5-57)||(34940638-34940690)
[»] chr3 (24 HSPs)
chr3 (206-288)||(44570468-44570550)
chr3 (206-287)||(10854805-10854886)
chr3 (206-285)||(12050986-12051065)
chr3 (206-288)||(46317432-46317513)
chr3 (5-57)||(40700789-40700841)
chr3 (206-285)||(32415518-32415596)
chr3 (206-287)||(51817394-51817475)
chr3 (206-253)||(36730235-36730282)
chr3 (206-253)||(8715583-8715630)
chr3 (206-253)||(9067470-9067517)
chr3 (206-285)||(31647253-31647331)
chr3 (206-252)||(4759932-4759978)
chr3 (206-272)||(8847534-8847600)
chr3 (206-252)||(12905364-12905410)
chr3 (206-252)||(20227462-20227508)
chr3 (206-260)||(25102403-25102457)
chr3 (206-252)||(29915657-29915703)
chr3 (206-252)||(29964810-29964856)
chr3 (206-287)||(52570729-52570809)
chr3 (25-57)||(21748191-21748223)
chr3 (206-249)||(44695753-44695796)
chr3 (206-252)||(35306313-35306359)
chr3 (5-53)||(28457546-28457594)
chr3 (260-288)||(36730303-36730331)
[»] chr2 (22 HSPs)
chr2 (206-288)||(6999147-6999229)
chr2 (206-288)||(2966485-2966567)
chr2 (5-57)||(13995502-13995554)
chr2 (206-283)||(9201577-9201653)
chr2 (206-253)||(39401616-39401663)
chr2 (206-284)||(39085874-39085952)
chr2 (206-252)||(862570-862616)
chr2 (206-283)||(1321117-1321195)
chr2 (206-283)||(44173070-44173146)
chr2 (5-57)||(19696031-19696083)
chr2 (206-253)||(11445401-11445448)
chr2 (206-253)||(15004907-15004954)
chr2 (206-253)||(17056139-17056186)
chr2 (206-253)||(17068586-17068633)
chr2 (206-253)||(27495103-27495150)
chr2 (206-253)||(35445373-35445420)
chr2 (206-253)||(41436458-41436505)
chr2 (206-252)||(16361547-16361593)
chr2 (206-253)||(17074569-17074616)
chr2 (206-253)||(17118454-17118501)
chr2 (206-253)||(34334243-34334290)
chr2 (206-252)||(23685734-23685780)
[»] chr1 (24 HSPs)
chr1 (206-286)||(27209800-27209880)
chr1 (206-288)||(4940819-4940901)
chr1 (206-286)||(22346316-22346396)
chr1 (5-57)||(37346121-37346173)
chr1 (206-284)||(43433724-43433802)
chr1 (206-288)||(49508812-49508894)
chr1 (206-286)||(6170630-6170710)
chr1 (206-286)||(7190554-7190634)
chr1 (206-253)||(34874547-34874594)
chr1 (206-252)||(33929947-33929993)
chr1 (206-253)||(24140753-24140800)
chr1 (206-253)||(50154453-50154500)
chr1 (206-284)||(47895283-47895361)
chr1 (5-50)||(28620621-28620666)
chr1 (206-251)||(47655450-47655495)
chr1 (210-254)||(49901905-49901949)
chr1 (206-253)||(11385961-11386008)
chr1 (206-253)||(29966802-29966849)
chr1 (206-253)||(41147557-41147604)
chr1 (208-286)||(8244044-8244122)
chr1 (206-253)||(932236-932283)
chr1 (206-241)||(42607403-42607438)
chr1 (212-253)||(9055897-9055938)
chr1 (212-288)||(45721700-45721776)
[»] chr6 (17 HSPs)
chr6 (206-283)||(26572159-26572236)
chr6 (206-284)||(7875263-7875341)
chr6 (206-286)||(7880509-7880589)
chr6 (206-285)||(12191442-12191520)
chr6 (5-57)||(391048-391100)
chr6 (206-282)||(16437664-16437740)
chr6 (5-57)||(23404833-23404885)
chr6 (5-57)||(32329686-32329738)
chr6 (206-253)||(32786049-32786096)
chr6 (5-57)||(9315154-9315206)
chr6 (5-57)||(12255459-12255511)
chr6 (206-252)||(7274296-7274342)
chr6 (5-57)||(10789186-10789238)
chr6 (5-57)||(29969591-29969643)
chr6 (206-253)||(5578254-5578301)
chr6 (206-285)||(10855381-10855459)
chr6 (206-271)||(8324186-8324251)
[»] scaffold0062 (3 HSPs)
scaffold0062 (206-253)||(16853-16900)
scaffold0062 (206-253)||(27021-27068)
scaffold0062 (206-253)||(37187-37234)
[»] scaffold0002 (1 HSPs)
scaffold0002 (206-256)||(392214-392264)


Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 22)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 198 - 373
Target Start/End: Complemental strand, 3174491 - 3174316
Alignment:
198 gtcaaaataaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccctttgcataatta 297  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3174491 gtcaaaataaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccctttgcataatta 3174392  T
298 agaaagccatcgacaaatgattaaaaattcgaacactttaagagtccgtttgatggtcaggatagagacagaattt 373  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3174391 agaaagctatcgacaaatgattaaaaattcgaacactttaagagtccgtttgatggtcaggatagagacagaattt 3174316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 212 - 285
Target Start/End: Complemental strand, 4989957 - 4989884
Alignment:
212 tgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    ||||||||||||| ||||||||||||||||| ||||||||||  ||||||||||||||||||||||||||||||    
4989957 tgttgaaaccaatgcaaacatgctacttttgacttccttaaccattgccatgagggcaatggttagcaagaccc 4989884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 3174320 - 3174264
Alignment:
1 aatttgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3174320 aatttgatataaagctggatagatataggatatgataaggacatgataaacattaat 3174264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 51 - 137
Target Start/End: Complemental strand, 3174637 - 3174552
Alignment:
51 cattaatttacttatacaattcatatttttggnnnnnnnnnngcaaaaggagaatgctaaccattgtctagggcgttggatgagggg 137  Q
    ||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||||||||    
3174637 cattaatttacttatacaattcatatttttggttttttttt-gcaaaaggagaatgctaaccattgtctagggcgttggatgagggg 3174552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 11656111 - 11656163
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    |||||||||| |||||||| |||||||||||||||||||||||||||||||||    
11656111 tgatataaagttggatagagataggatatgataaggacatgataaacattaat 11656163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 16295735 - 16295683
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||||||||||||| ||| |||||||||||||||||||||||||||||    
16295735 tgatataaagctggatagagatatgatatgataaggacatgataaacattaat 16295683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 16303437 - 16303385
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||||||||||||| ||| |||||||||||||||||||||||||||||    
16303437 tgatataaagctggatagagatatgatatgataaggacatgataaacattaat 16303385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 27696629 - 27696577
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||||||||||||| ||| |||||||||||||||||||||||||||||    
27696629 tgatataaagctggatagaaatatgatatgataaggacatgataaacattaat 27696577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 37246559 - 37246507
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||||||||||||| |||||||||||||||||||||||||| ||||||    
37246559 tgatataaagctggatagagataggatatgataaggacatgataaatattaat 37246507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 7 - 57
Target Start/End: Complemental strand, 40953626 - 40953576
Alignment:
7 atataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||||||||||| |||||||||||||| ||||||||||||||||||    
40953626 atataaagctggatagagataggatatgataacgacatgataaacattaat 40953576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 43597231 - 43597179
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    |||||||||| |||||||| ||| |||||||||||||||||||||||||||||    
43597231 tgatataaagttggatagagatatgatatgataaggacatgataaacattaat 43597179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 287
Target Start/End: Complemental strand, 26672817 - 26672736
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccctt 287  Q
    |||||||||||||||||||| ||||||  || |||||  |||||||||  ||||| | ||||||||| ||||||||||||||    
26672817 aaatgttgttgaaaccaatataaacatcgtatttttgatttccttaaccattgccctcagggcaatgattagcaagaccctt 26672736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 34714003 - 34714048
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttcctta 251  Q
    ||||||||||||||||||| ||||||||||||||||| ||||||||    
34714003 aaatgttgttgaaaccaatgcaaacatgctacttttgacttcctta 34714048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 205 - 253
Target Start/End: Complemental strand, 44874361 - 44874313
Alignment:
205 taaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||| ||||||||||||||| ||||||||||||||||| ||||||||||    
44874361 taaaagttgttgaaaccaatgcaaacatgctacttttgtcttccttaac 44874313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 241
Target Start/End: Original strand, 26195455 - 26195490
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctactttt 241  Q
    ||||||||||||||||||||||||||||||||||||    
26195455 aaatgttgttgaaaccaatacaaacatgctactttt 26195490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 21016139 - 21016185
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    ||||||||||||| ||||| ||||||||||||||||| |||||||||    
21016139 aaatgttgttgaagccaatgcaaacatgctacttttgacttccttaa 21016185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 285
Target Start/End: Complemental strand, 6433571 - 6433492
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    |||| ||||| |||||||| |||| || ||||||||| ||||||||||  ||||  ||||||||||| ||||| ||||||    
6433571 aaatattgttaaaaccaatgcaaagatactacttttgtcttccttaaccattgctctgagggcaatgattagcgagaccc 6433492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 10694834 - 10694787
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||||||||||||| |||| |||| ||| |||||||||||||||||||    
10694834 aaatgttgttgaaatcaatgcaaatatgatacttttggcttccttaac 10694787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 14855466 - 14855513
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||||||||| |||| ||| |||||||||||||||||| |||||||||    
14855466 aaatgttgttaaaactaatgcaaacatgctacttttggtttccttaac 14855513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 37433293 - 37433247
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    ||||||||||||||||||| ||||||| ||||||||  |||||||||    
37433293 aaatgttgttgaaaccaatgcaaacatactacttttaacttccttaa 37433247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 285
Target Start/End: Original strand, 11295552 - 11295625
Alignment:
212 tgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    |||||||  ||||| ||| || ||| |||||| |||||||||  ||| |||||||||| |||||||||||||||    
11295552 tgttgaattcaatataaatatactaattttggtttccttaaccattgtcatgagggcactggttagcaagaccc 11295625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 42180708 - 42180664
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataa 49  Q
    |||||||||| || ||||| ||| |||||||||||||||||||||    
42180708 tgatataaagttgtatagagatatgatatgataaggacatgataa 42180664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 64; Significance: 7e-28; HSPs: 18)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 206 - 285
Target Start/End: Complemental strand, 29687503 - 29687424
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||| | ||||| ||||||||||||||||||||||||    
29687503 aaatgttgttgaaaccaatgcaaacatgctacttttggcttccttaagtattgccttgagggcaatggttagcaagaccc 29687424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 206 - 288
Target Start/End: Complemental strand, 1910271 - 1910189
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacccttt 288  Q
    ||||||||||||||| |||  |||||||||||||||| |||| |||||  ||||| ||| |||||||||||||||||||||||    
1910271 aaatgttgttgaaacaaatgtaaacatgctacttttgacttctttaaccattgccctgatggcaatggttagcaagacccttt 1910189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 24359790 - 24359837
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||    
24359790 aaatgttgttgaaaccaatgcaaacatgctacttttggcttccttaac 24359837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 206 - 287
Target Start/End: Complemental strand, 8292772 - 8292691
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccctt 287  Q
    |||||||||||||| |||| ||||||||||||||||| ||||||||||  ||||| | | | ||||||||||||| ||||||    
8292772 aaatgttgttgaaatcaatccaaacatgctacttttgacttccttaaccattgccctcacgacaatggttagcaaaaccctt 8292691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 5240414 - 5240461
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||| ||||||||||| ||||||||||||||||||||||||||||    
5240414 aaatgttattgaaaccaatgcaaacatgctacttttggcttccttaac 5240461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 285
Target Start/End: Original strand, 7323035 - 7323114
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    ||||||||||||||||||| ||||||||||||||||| |||| |||||  ||||  | ||| ||||| ||||||||||||    
7323035 aaatgttgttgaaaccaatgcaaacatgctacttttgacttctttaaccattgctctcaggacaatgattagcaagaccc 7323114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 7 - 57
Target Start/End: Original strand, 18502834 - 18502884
Alignment:
7 atataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    |||||||| |||||||| ||||||||| |||||||||||||||||||||||    
18502834 atataaagttggatagagataggatataataaggacatgataaacattaat 18502884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 212 - 252
Target Start/End: Original strand, 5348057 - 5348097
Alignment:
212 tgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    ||||||||||||| |||||||||||||||||||||||||||    
5348057 tgttgaaaccaatgcaaacatgctacttttggcttccttaa 5348097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 8380468 - 8380421
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||||||||||||||||||  |||||| ||||||||||||||||||||    
8380468 aaatgttgttgaaaccaatgaaaacatactacttttggcttccttaac 8380421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 22521613 - 22521566
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| ||||||||||||||||| ||| ||||||    
22521613 aaatgttgttgaaaccaatgcaaacatgctacttttgactttcttaac 22521566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 29034714 - 29034667
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||| ||| ||||||||||||||||||||| ||||||    
29034714 aaatgttgttgaaactaatgcaaacatgctacttttggctttcttaac 29034667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 211 - 253
Target Start/End: Complemental strand, 49069577 - 49069535
Alignment:
211 ttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||||||| ||||||||| |||||||||    
49069577 ttgttgaaaccaatacaaacatgttacttttggtttccttaac 49069535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 27053575 - 27053622
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||| |||||||||||||| ||||||| |||||||||| |||||||||    
27053575 aaatattgttgaaaccaatgcaaacattctacttttggtttccttaac 27053622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 241
Target Start/End: Complemental strand, 40194853 - 40194818
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctactttt 241  Q
    ||||||||||||||||||| ||||||||||||||||    
40194853 aaatgttgttgaaaccaatgcaaacatgctactttt 40194818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 42222248 - 42222201
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||| ||||||||||||||||||||||| ||||||| | |||||||||    
42222248 aaatattgttgaaaccaatacaaacatgttacttttagtttccttaac 42222201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 29959094 - 29959048
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    ||||||||||||||||||| |||||||  ||||||||| ||||||||    
29959094 aaatgttgttgaaaccaatgcaaacataatacttttggtttccttaa 29959048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 287
Target Start/End: Complemental strand, 48705630 - 48705577
Alignment:
234 ctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccctt 287  Q
    |||||||| | |||||||||  ||| |||||||||| |||||||||||||||||    
48705630 ctacttttagtttccttaaccattgtcatgagggcactggttagcaagaccctt 48705577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 6 - 38
Target Start/End: Complemental strand, 6110479 - 6110447
Alignment:
6 gatataaagctggatagatataggatatgataa 38  Q
    |||||||||||||||||| ||||||||||||||    
6110479 gatataaagctggatagagataggatatgataa 6110447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 64; Significance: 7e-28; HSPs: 21)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 206 - 289
Target Start/End: Original strand, 16315614 - 16315697
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccctttg 289  Q
    ||||||||||||||||||| |||||| |||||||||||||||||||||  ||||| ||||||||||||||||||||||||||||    
16315614 aaatgttgttgaaaccaatgcaaacacgctacttttggcttccttaaccattgccctgagggcaatggttagcaagaccctttg 16315697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 206 - 285
Target Start/End: Original strand, 35653337 - 35653416
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    ||||||||||||||||||| |||||||| |||||||||||||||||||  ||||| ||||||||||||||||||||||||    
35653337 aaatgttgttgaaaccaatgcaaacatggtacttttggcttccttaaccattgccctgagggcaatggttagcaagaccc 35653416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 213 - 287
Target Start/End: Original strand, 25017380 - 25017454
Alignment:
213 gttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccctt 287  Q
    |||||||||||||||||||||||||||||| ||||||||||  ||||  |||| |||||||||||||||||||||    
25017380 gttgaaaccaatacaaacatgctacttttgacttccttaaccattgctttgagagcaatggttagcaagaccctt 25017454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 211 - 284
Target Start/End: Complemental strand, 39567925 - 39567852
Alignment:
211 ttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacc 284  Q
    |||||||||||||| ||||||||||||||||| |||||||||   ||||| |||||||||||||||||||||||    
39567925 ttgttgaaaccaatgcaaacatgctacttttgacttccttaatcattgccctgagggcaatggttagcaagacc 39567852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 206 - 285
Target Start/End: Complemental strand, 5151516 - 5151437
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    ||||||||||||||| ||| ||||||||||||||||| |||||||||| |||| | |||| ||||||||||| |||||||    
5151516 aaatgttgttgaaactaatgcaaacatgctacttttgccttccttaaccgttgtcctgagagcaatggttagtaagaccc 5151437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 206 - 288
Target Start/End: Complemental strand, 34546805 - 34546723
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacccttt 288  Q
    ||||||||||||||| ||| |||| ||| |||||||||||||||||||  ||||| | |||||||| ||||||||||||||||    
34546805 aaatgttgttgaaactaatgcaaaaatgatacttttggcttccttaaccattgcccttagggcaatagttagcaagacccttt 34546723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 206 - 286
Target Start/End: Complemental strand, 8410169 - 8410089
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccct 286  Q
    ||||||| || |||||||||||||||||||| |||||||||||||||   ||||| ||||||||||| ||| |||||||||    
8410169 aaatgttattaaaaccaatacaaacatgctagttttggcttccttaatcattgccttgagggcaatgattaacaagaccct 8410089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 206 - 288
Target Start/End: Original strand, 13951318 - 13951393
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacccttt 288  Q
    ||||||||||||||||||| ||| ||||||||||||||||||||||||  |||||       |||||||||||||||||||||    
13951318 aaatgttgttgaaaccaatgcaagcatgctacttttggcttccttaaccattgcc-------caatggttagcaagacccttt 13951393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 285
Target Start/End: Complemental strand, 12914202 - 12914123
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    |||| |||||||||||||| ||||||| ||||||||||||||||||||  || || | ||||||||| ||| ||||||||    
12914202 aaatattgttgaaaccaatgcaaacatactacttttggcttccttaaccattaccctcagggcaatgattatcaagaccc 12914123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 28143205 - 28143252
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||| |||||||||||||||||||||||||| |||||    
28143205 aaatgttgttgaaactaatacaaacatgctacttttggcttctttaac 28143252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 25346815 - 25346867
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    |||||||||| ||||||||  ||||||||||||| ||||||||||||||||||    
25346815 tgatataaagttggatagagttaggatatgataaagacatgataaacattaat 25346867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 212 - 287
Target Start/End: Complemental strand, 27823283 - 27823207
Alignment:
212 tgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccat-gagggcaatggttagcaagaccctt 287  Q
    |||||||| |||||||||||||||| ||||| |||||||||   ||||| | |||||||||||| ||||||||||||    
27823283 tgttgaaatcaatacaaacatgctaattttgacttccttaatcattgccctggagggcaatggtcagcaagaccctt 27823207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 29861266 - 29861214
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    |||||||||| |||||||| ||| |||||||||| ||||||||||||||||||    
29861266 tgatataaagttggatagagataagatatgataatgacatgataaacattaat 29861214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 5 - 55
Target Start/End: Original strand, 15921948 - 15921998
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacatta 55  Q
    ||||||||||||||||| | |||| ||||||||| ||||||||||||||||    
15921948 tgatataaagctggatataaatagaatatgataaagacatgataaacatta 15921998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 286
Target Start/End: Original strand, 3639156 - 3639236
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccct 286  Q
    |||| |||||||||||||| |||||||  |||||||| ||||||||||  ||  | ||| ||||||||||| |||||||||    
3639156 aaatattgttgaaaccaatgcaaacatattacttttgacttccttaaccattatcctgaaggcaatggttaacaagaccct 3639236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 242
Target Start/End: Original strand, 4962598 - 4962634
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttg 242  Q
    ||||||||||||||| |||||||||||||||||||||    
4962598 aaatgttgttgaaactaatacaaacatgctacttttg 4962634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 33007760 - 33007804
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataa 49  Q
    ||||||||||||||||||| ||| |||||||||| ||||||||||    
33007760 tgatataaagctggatagagataagatatgataatgacatgataa 33007804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 39693037 - 39692990
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||| ||||||||| ||||||||||||| |||||||| ||||||||||    
39693037 aaatattgttgaaatcaatacaaacatgttacttttgacttccttaac 39692990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 206 - 279
Target Start/End: Original strand, 4422046 - 4422119
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagca 279  Q
    |||||||||||||  |||| |||||||| |||||||| ||||||||||  ||||| | || |||||||| ||||    
4422046 aaatgttgttgaagtcaatgcaaacatgttacttttgacttccttaaccattgccctcagtgcaatggtcagca 4422119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 7883569 - 7883606
Alignment:
20 tagatataggatatgataaggacatgataaacattaat 57  Q
    |||| ||||||||||||||||||||| |||||||||||    
7883569 tagagataggatatgataaggacatgttaaacattaat 7883606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 206 - 242
Target Start/End: Original strand, 43414146 - 43414182
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttg 242  Q
    ||||||||||||||||||| |||||||| ||||||||    
43414146 aaatgttgttgaaaccaatgcaaacatgttacttttg 43414182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 61; Significance: 4e-26; HSPs: 30)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 206 - 286
Target Start/End: Original strand, 47188747 - 47188827
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccct 286  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||  ||||| ||| |||||||||||||||||||||    
47188747 aaatgttgttgaaaccaatgcaaacatgctacttttggcttccttaaccattgccctgatggcaatggttagcaagaccct 47188827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 206 - 287
Target Start/End: Complemental strand, 45688770 - 45688689
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccctt 287  Q
    ||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||| |||  |||||||||||||||||||||    
45688770 aaatgttgttgaaactaatgcaaacatgctacttttggcttccttaactattgccctgaatgcaatggttagcaagaccctt 45688689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 206 - 284
Target Start/End: Complemental strand, 23765605 - 23765527
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacc 284  Q
    ||||||||||||||||||| |||||||||||||||| |||||||||||  ||| | |||||||||||||||||||||||    
23765605 aaatgttgttgaaaccaatgcaaacatgctacttttagcttccttaacaattgtcctgagggcaatggttagcaagacc 23765527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 206 - 285
Target Start/End: Original strand, 50514695 - 50514774
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    ||||||||||||||||||| |||||||||||||||||| |||||||||  ||| |||  |||||||||||||||||||||    
50514695 aaatgttgttgaaaccaatgcaaacatgctacttttggtttccttaaccattgacatcggggcaatggttagcaagaccc 50514774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 206 - 284
Target Start/End: Complemental strand, 30475452 - 30475374
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacc 284  Q
    |||| |||||||||||||| |||||||  |||||||||||||||||||| ||||  |||||||||||||||||||||||    
30475452 aaatattgttgaaaccaatgcaaacatattacttttggcttccttaactattgctctgagggcaatggttagcaagacc 30475374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 206 - 287
Target Start/End: Original strand, 34316805 - 34316886
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccctt 287  Q
    |||| |||||||||||||| ||||||||||||||||||||||||||||  ||| |  ||||||||||| |||||||||||||    
34316805 aaatattgttgaaaccaatgcaaacatgctacttttggcttccttaaccattgtcccgagggcaatggctagcaagaccctt 34316886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 206 - 287
Target Start/End: Complemental strand, 2362656 - 2362575
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccctt 287  Q
    |||||||||| |||||||| ||||||| ||||||||| ||||||||||  ||||| ||| ||||||||||||| ||||||||    
2362656 aaatgttgttaaaaccaatgcaaacatactacttttgacttccttaaccattgccctgaaggcaatggttagcgagaccctt 2362575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 206 - 271
Target Start/End: Complemental strand, 33951727 - 33951662
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaat 271  Q
    |||||||||||||||||||||||||||| || ||||||||||||||||  ||||| ||||||||||    
33951727 aaatgttgttgaaaccaatacaaacatgttaattttggcttccttaaccattgccctgagggcaat 33951662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 5787040 - 5787092
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||||||||||||| |||| ||||||||||||||||||||||||||||    
5787040 tgatataaagctggatagagatagaatatgataaggacatgataaacattaat 5787092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 206 - 285
Target Start/End: Original strand, 26831868 - 26831946
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    ||||||||||||||| ||| ||||||||||||||||| |||| |||||  |||||| ||||| |||||||||||||||||    
26831868 aaatgttgttgaaac-aatgcaaacatgctacttttgacttctttaacgattgccacgagggtaatggttagcaagaccc 26831946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 35808478 - 35808525
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||    
35808478 aaatgttgttgaaaccaatgcaaacatgctacttttggcttccttaac 35808525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 206 - 288
Target Start/End: Original strand, 26040442 - 26040524
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacccttt 288  Q
    |||| |||||||| ||||| |||| |||||||||||||||||||||||   |||  ||||| |||||||||||||||||||||    
26040442 aaatattgttgaagccaatgcaaatatgctacttttggcttccttaaccactgctctgaggacaatggttagcaagacccttt 26040524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 206 - 286
Target Start/End: Complemental strand, 31168161 - 31168081
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccct 286  Q
    |||||||||||||||||||  |||||| |||||||||||||| |||||  |||||  | | ||||||||||||||||||||    
31168161 aaatgttgttgaaaccaatgtaaacattctacttttggcttctttaaccattgcctcgggagcaatggttagcaagaccct 31168081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 206 - 286
Target Start/End: Original strand, 41956295 - 41956375
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccct 286  Q
    ||||||||||||| ||||| ||||||||||||||||| ||||||||||  ||||  ||||||||||| ||| |||| ||||    
41956295 aaatgttgttgaagccaatgcaaacatgctacttttgccttccttaaccattgctctgagggcaatgattaacaaggccct 41956375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 45498937 - 45498989
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    |||||||||| ||||| || |||||||||||||||||||||||||||||||||    
45498937 tgatataaagatggattgagataggatatgataaggacatgataaacattaat 45498989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 214 - 285
Target Start/End: Complemental strand, 54339132 - 54339061
Alignment:
214 ttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    |||||||||||  ||| |||||||||||| ||||||||||  ||||  ||||||||||||||||||||||||    
54339132 ttgaaaccaatgtaaatatgctacttttgacttccttaaccattgctctgagggcaatggttagcaagaccc 54339061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 206 - 288
Target Start/End: Original strand, 19329010 - 19329087
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacccttt 288  Q
    |||| |||||||||||||| ||||||||||||||||| ||||||||||     |  ||||||||||| |||||||||||||||    
19329010 aaatattgttgaaaccaatgcaaacatgctacttttgccttccttaac-----cattgagggcaatgattagcaagacccttt 19329087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 51266951 - 51266905
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    |||||||||||||| |||||||||||||||||||||| |||||||||    
51266951 aaatgttgttgaaatcaatacaaacatgctacttttgacttccttaa 51266905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 206 - 272
Target Start/End: Complemental strand, 55669766 - 55669700
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatg 272  Q
    |||||||||| ||| |||| ||||||||||||||||||||||||||||  ||||| | |||||||||    
55669766 aaatgttgttaaaaacaatgcaaacatgctacttttggcttccttaaccattgccctcagggcaatg 55669700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 34514242 - 34514190
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||||||| ||||| ||| ||||||||||||| |||||||||||||||    
34514242 tgatataaagctgaatagagataagatatgataaggagatgataaacattaat 34514190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 36198579 - 36198631
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    |||||||||| |||||||| |||| |||||||||| |||||||||||||||||    
36198579 tgatataaagttggatagagatagaatatgataagtacatgataaacattaat 36198631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 44289390 - 44289442
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||||||||||||| |||   |||||||||||||||||||||||||||    
44289390 tgatataaagctggatagagataaagtatgataaggacatgataaacattaat 44289442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 10100195 - 10100242
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| |||||||| |||||||||||| ||||||    
10100195 aaatgttgttgaaaccaatgcaaacatgttacttttggctttcttaac 10100242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 31754965 - 31754918
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||| |||||||||||||| ||||||||||||||||| ||||||||||    
31754965 aaatattgttgaaaccaatgcaaacatgctacttttgacttccttaac 31754918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 265
Target Start/End: Original strand, 53567035 - 53567094
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgag 265  Q
    |||||||||||||||  || ||||||||||||||||| ||||||||||| ||| ||||||    
53567035 aaatgttgttgaaactcatgcaaacatgctacttttgacttccttaactattgtcatgag 53567094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 5 - 55
Target Start/End: Original strand, 34510582 - 34510632
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacatta 55  Q
    |||||||||||||| |||| |||||||||||||| |||||||||| |||||    
34510582 tgatataaagctggttagagataggatatgataaagacatgataagcatta 34510632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 206 - 275
Target Start/End: Original strand, 9693553 - 9693622
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggtt 275  Q
    |||| |||||||||||||| ||||||||||| ||||| ||||||||||  ||||  ||||| ||||||||    
9693553 aaatattgttgaaaccaatgcaaacatgctatttttgacttccttaaccattgctctgaggacaatggtt 9693622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 37910427 - 37910479
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||| ||||| | | |||||||||||||| ||||||||||||||||||    
37910427 tgatataaaactggacaaagataggatatgataatgacatgataaacattaat 37910479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 20811290 - 20811243
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||||||||| ||| |||| |||||||||||||||||||||| |||||    
20811290 aaatgttgttaaaatcaatgcaaacatgctacttttggcttctttaac 20811243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 34940690 - 34940638
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    |||||||||  |||||||| ||| ||| |||||||| ||||||||||||||||    
34940690 tgatataaaattggatagagataagatttgataagggcatgataaacattaat 34940638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 59; Significance: 6e-25; HSPs: 24)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 206 - 288
Target Start/End: Original strand, 44570468 - 44570550
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacccttt 288  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||  |||||  ||||||||||||||||||||||||||    
44570468 aaatgttgttgaaatcaatgcaaacatgctacttttggcttccttaaccattgcccagagggcaatggttagcaagacccttt 44570550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 206 - 287
Target Start/End: Complemental strand, 10854886 - 10854805
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccctt 287  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||   ||| || |||||||||||||||||||||||||    
10854886 aaatgttgttgaaaccaatgcaaacatgctacttttggcttccttaatcattgtcacgagggcaatggttagcaagaccctt 10854805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 206 - 285
Target Start/End: Complemental strand, 12051065 - 12050986
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||  ||||| |||||| ||| |||||||||||||    
12051065 aaatgttgttgaaaacaatgcaaacatgctacttttggcttccttaaccattgccctgagggtaatagttagcaagaccc 12050986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 206 - 288
Target Start/End: Complemental strand, 46317513 - 46317432
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacccttt 288  Q
    ||||||||||||||||||| |||||||| |||||||||||||||||||  ||| | ||||||||||||||||||| |||||||    
46317513 aaatgttgttgaaaccaatgcaaacatgttacttttggcttccttaaccattgtc-tgagggcaatggttagcaaaacccttt 46317432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 40700789 - 40700841
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||    
40700789 tgatataaagctggatagagataggatatgataaggacatgataaacattaat 40700841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 206 - 285
Target Start/End: Complemental strand, 32415596 - 32415518
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    ||||||||||||||||||| |||||||| ||||||||| |||||||||  ||||| |||||||||| |||||||||||||    
32415596 aaatgttgttgaaaccaatgcaaacatgttacttttggtttccttaaccattgcc-tgagggcaatagttagcaagaccc 32415518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 206 - 287
Target Start/End: Original strand, 51817394 - 51817475
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccctt 287  Q
    |||| |||||||||| ||||||||||||||||||||||||||||||||  ||||| | |||| |||||||| ||| ||||||    
51817394 aaatattgttgaaactaatacaaacatgctacttttggcttccttaaccattgccctcagggtaatggttaacaaaaccctt 51817475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 36730235 - 36730282
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||    
36730235 aaatgttgttgaaaccaatgcaaacatgctacttttggcttccttaac 36730282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 8715583 - 8715630
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| |||||||||||||||| |||||||||||    
8715583 aaatgttgttgaaaccaatgcaaacatgctacttttagcttccttaac 8715630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 9067470 - 9067517
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| |||||||||||||||| |||||||||||    
9067470 aaatgttgttgaaaccaatgcaaacatgctacttttagcttccttaac 9067517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 285
Target Start/End: Complemental strand, 31647331 - 31647253
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    ||||||| |||||| |||| ||||||||||||||||||||||||||||  ||||  ||| | ||||||||||||||||||    
31647331 aaatgttattgaaatcaatgcaaacatgctacttttggcttccttaaccattgctctga-gacaatggttagcaagaccc 31647253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 4759932 - 4759978
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    ||||||||||||||||||| |||||||| ||||||||||||||||||    
4759932 aaatgttgttgaaaccaatgcaaacatgttacttttggcttccttaa 4759978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 206 - 272
Target Start/End: Original strand, 8847534 - 8847600
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatg 272  Q
    |||| ||||||||| ||||  ||||||||||||||||| |||||||||  |||||||||||||||||    
8847534 aaatattgttgaaaacaatgtaaacatgctacttttggtttccttaaccattgccatgagggcaatg 8847600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 12905364 - 12905410
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    ||||||||||||||||||| |||||||||||||||| ||||||||||    
12905364 aaatgttgttgaaaccaatgcaaacatgctactttttgcttccttaa 12905410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 20227462 - 20227508
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    ||||||| |||||||||||||||||||| |||||||| |||||||||    
20227462 aaatgttattgaaaccaatacaaacatgttacttttgacttccttaa 20227508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 260
Target Start/End: Original strand, 25102403 - 25102457
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgcc 260  Q
    |||| |||||||||||||| |||| ||||||||||||| |||||||||| |||||    
25102403 aaatattgttgaaaccaatgcaaatatgctacttttggtttccttaactattgcc 25102457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 29915657 - 29915703
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    |||||| |||||||||||| ||||||| |||||||||||||||||||    
29915657 aaatgtggttgaaaccaatgcaaacattctacttttggcttccttaa 29915703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 29964810 - 29964856
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    |||||| |||||||||||| ||||||| |||||||||||||||||||    
29964810 aaatgtggttgaaaccaatgcaaacattctacttttggcttccttaa 29964856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 287
Target Start/End: Complemental strand, 52570809 - 52570729
Alignment:
206 aaatgttgttgaaaccaatacaaacat--gctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccctt 287  Q
    |||| |||||||||||||| |||||||  |||||||||||| ||||||||  |||   |||| |||||||||||||||||||||    
52570809 aaatattgttgaaaccaatgcaaacatatgctacttttggcatccttaaccattg---tgagagcaatggttagcaagaccctt 52570729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 21748191 - 21748223
Alignment:
25 ataggatatgataaggacatgataaacattaat 57  Q
    |||||||||||||||||||||||||||||||||    
21748191 ataggatatgataaggacatgataaacattaat 21748223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 249
Target Start/End: Original strand, 44695753 - 44695796
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttcct 249  Q
    |||||||||||||| |||| |||||||| |||||||||||||||    
44695753 aaatgttgttgaaatcaatgcaaacatgttacttttggcttcct 44695796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 35306359 - 35306313
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    ||||||| |||||| |||| |||||||||||||||||| ||||||||    
35306359 aaatgttattgaaatcaatgcaaacatgctacttttggtttccttaa 35306313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 5 - 53
Target Start/End: Original strand, 28457546 - 28457594
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacat 53  Q
    |||||||||| || ||||||||| ||||||| || ||||||||||||||    
28457546 tgatataaagttgaatagatatatgatatgacaatgacatgataaacat 28457594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 260 - 288
Target Start/End: Original strand, 36730303 - 36730331
Alignment:
260 catgagggcaatggttagcaagacccttt 288  Q
    |||||||||||||||||||||||||||||    
36730303 catgagggcaatggttagcaagacccttt 36730331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 59; Significance: 6e-25; HSPs: 22)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 206 - 288
Target Start/End: Complemental strand, 6999229 - 6999147
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacccttt 288  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||  ||||| ||||| ||||||||||||| |||||||    
6999229 aaatgttgttgaaaccaatgcaaacatgctacttttggcttccttaaccattgccctgaggacaatggttagcaaaacccttt 6999147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 206 - 288
Target Start/End: Complemental strand, 2966567 - 2966485
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacccttt 288  Q
    ||||||||||||||||||| |||| ||||||||||| |||||||||||  ||||| ||||| ||||| |||||||||||||||    
2966567 aaatgttgttgaaaccaatgcaaatatgctacttttagcttccttaaccattgccctgaggacaatgattagcaagacccttt 2966485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 13995502 - 13995554
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||    
13995502 tgatataaagctggatagatataggatatgacaaggacatgataaacattaat 13995554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 206 - 283
Target Start/End: Original strand, 9201577 - 9201653
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagac 283  Q
    ||||||||||||| |||||||||||||| |||||||| |||| |||||| ||||| |||||||||| |||||||||||    
9201577 aaatgttgttgaa-ccaatacaaacatgttacttttgacttctttaactattgccctgagggcaatagttagcaagac 9201653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 39401616 - 39401663
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||    
39401616 aaattttgttgaaaccaatacaaacatgctacttttggcttccttaac 39401663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 206 - 284
Target Start/End: Original strand, 39085874 - 39085952
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacc 284  Q
    |||||||||||||| |||| |||||||||| |||||| ||||||||||  ||||  ||||| |||||||||||||||||    
39085874 aaatgttgttgaaatcaatgcaaacatgctgcttttgacttccttaaccattgctctgaggacaatggttagcaagacc 39085952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 862616 - 862570
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    |||| |||||||||||||| |||||||||||||||||||||||||||    
862616 aaatcttgttgaaaccaatgcaaacatgctacttttggcttccttaa 862570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 206 - 283
Target Start/End: Complemental strand, 1321195 - 1321117
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa-ctgttgccatgagggcaatggttagcaagac 283  Q
    |||||||||||||| ||||  ||||||||||  |||||||||||||| |  ||||| ||||||||||||||||||||||    
1321195 aaatgttgttgaaatcaatgtaaacatgctaactttggcttccttaacccattgccctgagggcaatggttagcaagac 1321117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 283
Target Start/End: Complemental strand, 44173146 - 44173070
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagac 283  Q
    |||||||||||||||||||||||||||  || |||||||||| ||||| |||| | |||| | |||||||||||||||    
44173146 aaatgttgttgaaaccaatacaaacatatta-ttttggcttctttaaccgttgtcctgagagtaatggttagcaagac 44173070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 19696083 - 19696031
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    |||||||||| |||||||| ||| |||| ||||||||||||||||||||||||    
19696083 tgatataaagttggatagaaatatgatacgataaggacatgataaacattaat 19696031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 11445401 - 11445448
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| |||||||| ||||||||| |||||||||    
11445401 aaatgttgttgaaaccaatgcaaacatgttacttttggtttccttaac 11445448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 15004954 - 15004907
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||||||||||||||||||||||||||| |||||||| |||| |||||    
15004954 aaatgttgttgaaaccaatacaaacatgatacttttgacttctttaac 15004907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 17056139 - 17056186
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| |||| |||||| ||||||||||||||||    
17056139 aaatgttgttgaaaccaatgcaaatatgctatttttggcttccttaac 17056186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 17068586 - 17068633
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| |||| |||||| ||||||||||||||||    
17068586 aaatgttgttgaaaccaatgcaaatatgctatttttggcttccttaac 17068633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 27495150 - 27495103
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| ||||||| ||||||||| ||||||||||    
27495150 aaatgttgttgaaaccaatgcaaacatactacttttgacttccttaac 27495103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 35445373 - 35445420
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||| |||||||||||||||||||||||||||||||| ||| ||||||    
35445373 aaatattgttgaaaccaatacaaacatgctacttttgacttgcttaac 35445420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 41436505 - 41436458
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| ||||||||||||||||| |||| |||||    
41436505 aaatgttgttgaaaccaatgcaaacatgctacttttgacttcattaac 41436458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 16361593 - 16361547
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    ||||||||| ||||||||| |||||||| ||||||||||||||||||    
16361593 aaatgttgtcgaaaccaatgcaaacatgttacttttggcttccttaa 16361547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 17074569 - 17074616
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||| ||| |||| |||||| ||||||||||||||||    
17074569 aaatgttgttgaaactaatgcaaatatgctatttttggcttccttaac 17074616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 17118454 - 17118501
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| |||| ||| || ||||||||||||||||    
17118454 aaatgttgttgaaaccaatgcaaatatgttatttttggcttccttaac 17118501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 34334243 - 34334290
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||| |||||||| |||||||||||||||||||||| | |||||||||    
34334243 aaatattgttgaatccaatacaaacatgctacttttagtttccttaac 34334290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 23685734 - 23685780
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    ||||||| |||||| |||| |||||||| ||||||||||||||||||    
23685734 aaatgttattgaaatcaatgcaaacatgttacttttggcttccttaa 23685780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 57; Significance: 1e-23; HSPs: 24)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 206 - 286
Target Start/End: Original strand, 27209800 - 27209880
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccct 286  Q
    ||||||||||||||||||| ||||||| ||||||||||||||||||||  ||||| | |||||||||||||||||||||||    
27209800 aaatgttgttgaaaccaatgcaaacatcctacttttggcttccttaaccattgccctcagggcaatggttagcaagaccct 27209880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 206 - 288
Target Start/End: Original strand, 4940819 - 4940901
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacccttt 288  Q
    |||| ||||| |||||||||||||||||||| |||||| |||||||||| ||||| ||||| || ||||||||||||||||||    
4940819 aaatattgttaaaaccaatacaaacatgctatttttggtttccttaactattgccctgaggacagtggttagcaagacccttt 4940901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 206 - 286
Target Start/End: Original strand, 22346316 - 22346396
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccct 286  Q
    |||| |||||||||||||| ||||||||||||||||||||||||||||  ||| | | | |||||||||||||||||||||    
22346316 aaatattgttgaaaccaatgcaaacatgctacttttggcttccttaaccattgtcctcaaggcaatggttagcaagaccct 22346396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 37346121 - 37346173
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||    
37346121 tgatataaagctggatagagataggatatgataaggacatgataaacattaat 37346173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 206 - 284
Target Start/End: Complemental strand, 43433802 - 43433724
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacc 284  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||  || || | | |||||| ||||||||||||    
43433802 aaatgttgttgaaaccaatacaaacatactacttttggcttccttaaccattaccctcaaggcaatagttagcaagacc 43433724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 206 - 288
Target Start/End: Original strand, 49508812 - 49508894
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacccttt 288  Q
    |||| |||| ||||||||| |||||||||||||||||||||| |||||  ||| | |||||||||| ||||||||||||||||    
49508812 aaatattgtcgaaaccaatgcaaacatgctacttttggcttctttaaccattgtcttgagggcaatagttagcaagacccttt 49508894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 206 - 286
Target Start/End: Original strand, 6170630 - 6170710
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccct 286  Q
    ||||||||||||||||||| |||||||| |||||||| ||||||||||  ||||| | |||||||||| ||| ||||||||    
6170630 aaatgttgttgaaaccaatgcaaacatgttacttttgacttccttaaccattgccttaagggcaatggatagtaagaccct 6170710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 206 - 286
Target Start/End: Original strand, 7190554 - 7190634
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccct 286  Q
    ||||| ||||||||| ||| |||||||||||||||| |||||||||||  ||| | | |||||||||||||||||||||||    
7190554 aaatggtgttgaaactaatgcaaacatgctacttttagcttccttaaccattgtcctaagggcaatggttagcaagaccct 7190634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 34874594 - 34874547
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||    
34874594 aaatgttgttgaaaccaatgcaaacatgctacttttggcttccttaac 34874547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 33929993 - 33929947
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||    
33929993 aaatgttgttgaaaccaatgcaaacatgctacttttggcttccttaa 33929947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 24140800 - 24140753
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| ||||||||||| ||||||||||||||||    
24140800 aaatgttgttgaaaccaatgcaaacatgctatttttggcttccttaac 24140753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 50154500 - 50154453
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| |||||||| |||||||||||||||||||    
50154500 aaatgttgttgaaaccaatgcaaacatgttacttttggcttccttaac 50154453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 206 - 284
Target Start/End: Complemental strand, 47895361 - 47895283
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacc 284  Q
    |||| |||||||||| ||| |||||||| |||||||||||||||||||  ||||  ||||| ||||||||| |||||||    
47895361 aaatattgttgaaactaatgcaaacatgttacttttggcttccttaaccattgctctgaggacaatggttaacaagacc 47895283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 5 - 50
Target Start/End: Original strand, 28620621 - 28620666
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaa 50  Q
    ||||||||||||||||||| ||||||||||||||| ||||||||||    
28620621 tgatataaagctggatagagataggatatgataagaacatgataaa 28620666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 47655450 - 47655495
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttcctta 251  Q
    ||||||||||||||||||| ||||||||||||||||| ||||||||    
47655450 aaatgttgttgaaaccaatgcaaacatgctacttttgccttcctta 47655495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 210 - 254
Target Start/End: Complemental strand, 49901949 - 49901905
Alignment:
210 gttgttgaaaccaatacaaacatgctacttttggcttccttaact 254  Q
    ||||||||||||||| |||||||| ||||||||||||||||||||    
49901949 gttgttgaaaccaatgcaaacatgatacttttggcttccttaact 49901905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 11386008 - 11385961
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| |||||||||||||||||| || ||||||    
11386008 aaatgttgttgaaaccaatgcaaacatgctacttttggttttcttaac 11385961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 29966849 - 29966802
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||| |||||||||||||| ||||||||||||||||| ||||||||||    
29966849 aaatattgttgaaaccaatgcaaacatgctacttttgacttccttaac 29966802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 41147557 - 41147604
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||| |||||||||||||| ||||||||||||||||| ||||||||||    
41147557 aaatattgttgaaaccaatgcaaacatgctacttttgacttccttaac 41147604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 208 - 286
Target Start/End: Complemental strand, 8244122 - 8244044
Alignment:
208 atgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccct 286  Q
    ||||| |||||||||||  ||||||| || ||||||||||||||||  ||||| || | ||||||||| ||||||||||    
8244122 atgtttttgaaaccaatggaaacatgttatttttggcttccttaaccattgccctgggtgcaatggtttgcaagaccct 8244044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 932236 - 932283
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||| ||| ||||||||||||||||  ||||||||||    
932236 aaatgttgttgaaactaatgcaaacatgctacttttaccttccttaac 932283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 241
Target Start/End: Original strand, 42607403 - 42607438
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctactttt 241  Q
    ||||||||||||||||||| ||||||||||||||||    
42607403 aaatgttgttgaaaccaatgcaaacatgctactttt 42607438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 253
Target Start/End: Original strand, 9055897 - 9055938
Alignment:
212 tgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||||| || ||| ||||||||||||||||||||||||||||    
9055897 tgttgagactaatgcaaacatgctacttttggcttccttaac 9055938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 212 - 288
Target Start/End: Complemental strand, 45721776 - 45721700
Alignment:
212 tgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacccttt 288  Q
    |||| ||| |||| |||||||||||||||||  |||||||||  ||||||| |||  |||||| ||||||| |||||    
45721776 tgttaaaatcaatgcaaacatgctacttttgatttccttaaccattgccataaggtaaatggtcagcaagaaccttt 45721700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 50; Significance: 2e-19; HSPs: 17)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 206 - 283
Target Start/End: Original strand, 26572159 - 26572236
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagac 283  Q
    |||| ||||| |||||||| ||||||||||||||||| ||||||||||  ||||| ||||||||||||||||||||||    
26572159 aaatattgttaaaaccaatgcaaacatgctacttttgacttccttaaccattgccctgagggcaatggttagcaagac 26572236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 206 - 284
Target Start/End: Original strand, 7875263 - 7875341
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagacc 284  Q
    |||| |||||||||||||| || ||||||||||||||||||||||||   |||||  ||||||||||||||||||||||    
7875263 aaatattgttgaaaccaatgcagacatgctacttttggcttccttaatcattgccccgagggcaatggttagcaagacc 7875341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 206 - 286
Target Start/End: Original strand, 7880509 - 7880589
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccct 286  Q
    |||| |||||||||| |||||| ||||||||||||||||||||||||   |||||  ||||| ||||||||||||||||||    
7880509 aaatattgttgaaactaatacagacatgctacttttggcttccttaatcattgccccgagggtaatggttagcaagaccct 7880589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 206 - 285
Target Start/End: Complemental strand, 12191520 - 12191442
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    |||||||||||||| |||||||||||||||||||||| ||||||||||  |||||||  | |||||||| ||||||||||    
12191520 aaatgttgttgaaatcaatacaaacatgctacttttgccttccttaaccattgccat-cgagcaatggtcagcaagaccc 12191442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 391048 - 391100
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||||||||||||| ||| |||||||||| ||||||||||||||||||    
391048 tgatataaagctggatagagataagatatgataaagacatgataaacattaat 391100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 206 - 282
Target Start/End: Original strand, 16437664 - 16437740
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaaga 282  Q
    |||| |||||||||||||| ||||||||||||| |||| |||||||||  ||||| | ||||||||||||| |||||    
16437664 aaatattgttgaaaccaatgcaaacatgctactgttggtttccttaaccattgccctcagggcaatggttaacaaga 16437740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 23404885 - 23404833
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||||||||||| | ||| |||||||||||||||||||||||||||||    
23404885 tgatataaagctggataaagataagatatgataaggacatgataaacattaat 23404833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 32329738 - 32329686
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||| ||||||||| ||| |||||||||||||||||||||||||||||    
32329738 tgatataaaactggatagagataagatatgataaggacatgataaacattaat 32329686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 32786096 - 32786049
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    ||||||||||||||||||| |||||||||||||||||| |||||||||    
32786096 aaatgttgttgaaaccaatgcaaacatgctacttttggtttccttaac 32786049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 9315206 - 9315154
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||| ||| ||||||||| ||| |||||||||||||||||||||||||||||    
9315206 tgatacaaaactggatagagatatgatatgataaggacatgataaacattaat 9315154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 12255511 - 12255459
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    ||||||||| ||||||||| ||||||||| |||| ||||||||||||||||||    
12255511 tgatataaaactggatagagataggatattataaagacatgataaacattaat 12255459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 7274296 - 7274342
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaa 252  Q
    |||||||||||||| ||||||||||||| ||||||||| ||||||||    
7274296 aaatgttgttgaaatcaatacaaacatgttacttttggtttccttaa 7274342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 10789186 - 10789238
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    |||||||||||| |||||| ||| ||||||||||||| || ||||||||||||    
10789186 tgatataaagctagatagagataagatatgataaggatataataaacattaat 10789238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 29969591 - 29969643
Alignment:
5 tgatataaagctggatagatataggatatgataaggacatgataaacattaat 57  Q
    |||||||||  |||| ||| ||| |||||||||||||||||||||||||||||    
29969591 tgatataaaattggacagagatatgatatgataaggacatgataaacattaat 29969643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 5578301 - 5578254
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||| |||||||||| ||| ||||||||||||||||| ||||||||||    
5578301 aaatattgttgaaacaaatgcaaacatgctacttttgacttccttaac 5578254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 285
Target Start/End: Complemental strand, 10855459 - 10855381
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaatggttagcaagaccc 285  Q
    ||||||||||||||||| | |||| ||||||||||||  ||| |||||  ||||| | ||| ||||||||||||||||||    
10855459 aaatgttgttgaaacca-tgcaaatatgctacttttgatttctttaaccattgccctcaggacaatggttagcaagaccc 10855381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 206 - 271
Target Start/End: Original strand, 8324186 - 8324251
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgttgccatgagggcaat 271  Q
    |||||||||||||||||||| ||||||| || ||||  ||||||||||  ||| | ||||||||||    
8324186 aaatgttgttgaaaccaatataaacatgttatttttaccttccttaaccattgtcctgagggcaat 8324251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 3)
Name: scaffold0062
Description:

Target: scaffold0062; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 16853 - 16900
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||| |||||||||||||| ||||||||||||||||||||||||||||    
16853 aaatattgttgaaaccaatgcaaacatgctacttttggcttccttaac 16900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 27021 - 27068
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||| |||||||||||||| ||||||||||||||||||||||||||||    
27021 aaatattgttgaaaccaatgcaaacatgctacttttggcttccttaac 27068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 37187 - 37234
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaac 253  Q
    |||| |||||||||||||| ||||||||||||||||||||||||||||    
37187 aaatattgttgaaaccaatgcaaacatgctacttttggcttccttaac 37234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 206 - 256
Target Start/End: Original strand, 392214 - 392264
Alignment:
206 aaatgttgttgaaaccaatacaaacatgctacttttggcttccttaactgt 256  Q
    |||||||||||||||| || |||||||||||||||| ||||||||||||||    
392214 aaatgttgttgaaaccgatgcaaacatgctacttttcgcttccttaactgt 392264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175999 times since January 2019
Visitors: 1577