View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-31 (Length: 394)

Name: J5-6-31
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-31
J5-6-31
[»] chr8 (1 HSPs)
chr8 (1-383)||(10874097-10874479)


Alignment Details
Target: chr8 (Bit Score: 371; Significance: 0; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 371; E-Value: 0
Query Start/End: Original strand, 1 - 383
Target Start/End: Complemental strand, 10874479 - 10874097
Alignment:
1 ttatttgtggacgatagctttattttctttcgggaaaatganggagaggctcaacatcgtcatcatatgttgaatgtgtatgcngatgcttcagggcaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
10874479 ttatttgtggacgatagctttattttctttcgggaaaatgagggagaggctcaacatcgtcatcatatgttgaatgtgtatgctgatgcttcagggcaat 10874380  T
101 gcntaaatatttaacattactcggatctttgaagcttgagaaagtattgggacaggtaagtatctcggtcttccttccatcattggtagaagcaagangt 200  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
10874379 gcataaatatttaacattactcggatctttgaagcttgagaaagtattgggacaggtaagtatctcggtcttccttccatcattggtagaagcaagaggt 10874280  T
201 ctatctttaattacataaaagatagagtttggaagagaatatctagctggagtagcataatgttgtcacaagcaggtcgtgaattattgattaagttttg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10874279 ctatctttaattacataaaagatagagtttggaagagaatatctagctggagtagcataatgttgtcacaagcaggtcgtgaattattgattaagttttg 10874180  T
301 tggctcaagcaatacctttgtattgtatgaatgcatttcttatgcctaagacacttgcaaacgagattgaaaaaatgattaat 383  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10874179 tggctcaagcaatacctttgtattgtatgaatgcatttcttatgcctaagacacttgcaaacgagattgaaaaaatgattaat 10874097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126601 times since January 2019
Visitors: 1391