View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-49 (Length: 299)

Name: J5-6-49
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-49
J5-6-49
[»] chr2 (24 HSPs)
chr2 (1-254)||(21813225-21813478)
chr2 (147-232)||(31264087-31264172)
chr2 (149-254)||(41265183-41265289)
chr2 (248-299)||(21813474-21813525)
chr2 (151-245)||(39376262-39376355)
chr2 (194-251)||(27893117-27893174)
chr2 (163-254)||(34336114-34336214)
chr2 (147-255)||(30907245-30907359)
chr2 (190-252)||(20535934-20535996)
chr2 (190-232)||(19080739-19080781)
chr2 (190-232)||(36196475-36196517)
chr2 (193-254)||(39301807-39301868)
chr2 (190-230)||(20535555-20535595)
chr2 (222-254)||(31264004-31264036)
chr2 (154-232)||(5117014-5117092)
chr2 (222-252)||(30907155-30907185)
chr2 (208-246)||(37543034-37543072)
chr2 (190-232)||(42117178-42117220)
chr2 (154-184)||(42117196-42117226)
chr2 (147-208)||(16780981-16781042)
chr2 (222-254)||(11871763-11871795)
chr2 (192-232)||(15506478-15506518)
chr2 (222-254)||(27893573-27893605)
chr2 (17-117)||(45010899-45010999)
[»] chr6 (21 HSPs)
chr6 (147-246)||(16168553-16168652)
chr6 (147-232)||(20575523-20575609)
chr6 (153-232)||(32417647-32417726)
chr6 (153-232)||(32423488-32423567)
chr6 (190-252)||(11527618-11527680)
chr6 (190-254)||(2840032-2840096)
chr6 (194-254)||(2839705-2839765)
chr6 (190-242)||(9946685-9946737)
chr6 (192-254)||(28630599-28630661)
chr6 (190-232)||(10862558-10862600)
chr6 (2-99)||(20927264-20927361)
chr6 (192-245)||(24139087-24139140)
chr6 (20-133)||(26904544-26904657)
chr6 (190-232)||(17180110-17180152)
chr6 (222-255)||(2839644-2839677)
chr6 (151-184)||(20575457-20575490)
chr6 (151-184)||(32417574-32417607)
chr6 (151-184)||(32423415-32423448)
chr6 (153-185)||(10963161-10963193)
chr6 (222-254)||(17132227-17132259)
chr6 (222-254)||(20575609-20575641)
[»] chr7 (35 HSPs)
chr7 (1-121)||(8865245-8865365)
chr7 (147-246)||(36566450-36566549)
chr7 (153-254)||(31893330-31893431)
chr7 (147-232)||(21413038-21413123)
chr7 (147-215)||(33879410-33879478)
chr7 (147-232)||(4187618-4187703)
chr7 (153-232)||(19925272-19925351)
chr7 (193-254)||(1441416-1441477)
chr7 (147-232)||(34951338-34951423)
chr7 (190-246)||(8040127-8040183)
chr7 (192-238)||(39958783-39958829)
chr7 (190-254)||(5559599-5559662)
chr7 (18-102)||(17245498-17245582)
chr7 (190-232)||(5559220-5559262)
chr7 (190-232)||(8039757-8039799)
chr7 (190-232)||(10619911-10619953)
chr7 (208-254)||(31893474-31893520)
chr7 (190-231)||(20366159-20366200)
chr7 (191-252)||(28256918-28256979)
chr7 (190-254)||(35214887-35214960)
chr7 (190-254)||(42990989-42991052)
chr7 (193-232)||(28256604-28256643)
chr7 (190-232)||(1349120-1349162)
chr7 (190-232)||(27995551-27995593)
chr7 (222-252)||(31893437-31893467)
chr7 (194-232)||(33235145-33235183)
chr7 (190-232)||(39959165-39959207)
chr7 (226-254)||(5805058-5805086)
chr7 (248-299)||(8865361-8865413)
chr7 (190-246)||(10620206-10620262)
chr7 (222-254)||(19925350-19925382)
chr7 (226-254)||(20366068-20366096)
chr7 (222-254)||(21412946-21412978)
chr7 (222-254)||(21413006-21413038)
chr7 (222-254)||(27995141-27995173)
[»] chr4 (25 HSPs)
chr4 (147-232)||(26329875-26329960)
chr4 (147-232)||(22025164-22025249)
chr4 (147-221)||(36890575-36890649)
chr4 (147-232)||(43098289-43098373)
chr4 (193-252)||(44916294-44916353)
chr4 (203-254)||(52866347-52866398)
chr4 (190-242)||(19631859-19631911)
chr4 (18-121)||(27012741-27012844)
chr4 (194-241)||(52866049-52866096)
chr4 (149-218)||(35023910-35023979)
chr4 (13-99)||(6613642-6613728)
chr4 (190-252)||(30543108-30543170)
chr4 (190-232)||(31229366-31229408)
chr4 (190-254)||(52183404-52183468)
chr4 (194-232)||(30542731-30542769)
chr4 (221-254)||(2909255-2909288)
chr4 (191-232)||(8408832-8408873)
chr4 (151-184)||(26329993-26330026)
chr4 (151-184)||(41735857-41735890)
chr4 (222-254)||(2788987-2789019)
chr4 (192-228)||(19681304-19681340)
chr4 (222-254)||(26330019-26330051)
chr4 (222-254)||(31229335-31229367)
chr4 (222-254)||(52181795-52181827)
chr4 (222-254)||(52568207-52568239)
[»] chr8 (26 HSPs)
chr8 (149-232)||(9770725-9770808)
chr8 (147-246)||(11113638-11113737)
chr8 (147-232)||(36360011-36360096)
chr8 (196-252)||(14871342-14871398)
chr8 (149-229)||(45017860-45017940)
chr8 (147-232)||(29794196-29794280)
chr8 (198-254)||(23179066-23179122)
chr8 (190-254)||(40553228-40553292)
chr8 (208-254)||(9770640-9770686)
chr8 (20-133)||(43221046-43221159)
chr8 (193-232)||(9276593-9276632)
chr8 (190-232)||(23553465-23553507)
chr8 (190-232)||(34686878-34686920)
chr8 (194-246)||(6236222-6236274)
chr8 (154-184)||(5358687-5358717)
chr8 (222-252)||(8713867-8713897)
chr8 (190-232)||(9276965-9277006)
chr8 (194-232)||(16208674-16208712)
chr8 (190-232)||(39700995-39701037)
chr8 (195-232)||(5358693-5358730)
chr8 (190-254)||(30576640-30576713)
chr8 (192-232)||(13771468-13771508)
chr8 (222-254)||(25730144-25730176)
chr8 (222-254)||(25737630-25737662)
chr8 (193-229)||(39701376-39701412)
chr8 (222-254)||(39701474-39701506)
[»] scaffold0027 (1 HSPs)
scaffold0027 (193-254)||(9474-9535)
[»] scaffold0019 (1 HSPs)
scaffold0019 (147-220)||(124254-124327)
[»] chr3 (12 HSPs)
chr3 (147-232)||(54456722-54456807)
chr3 (190-254)||(14629305-14629369)
chr3 (191-254)||(4276597-4276660)
chr3 (190-244)||(3088073-3088127)
chr3 (147-252)||(5505595-5505700)
chr3 (190-252)||(35555954-35556016)
chr3 (190-238)||(21376990-21377038)
chr3 (192-243)||(33975069-33975120)
chr3 (147-200)||(14964776-14964829)
chr3 (193-254)||(50530326-50530386)
chr3 (35-123)||(14478808-14478896)
chr3 (20-120)||(44492146-44492246)
[»] chr1 (14 HSPs)
chr1 (147-232)||(1765804-1765889)
chr1 (193-254)||(49650984-49651045)
chr1 (2-137)||(41329266-41329401)
chr1 (193-254)||(27351518-27351579)
chr1 (193-254)||(49650653-49650715)
chr1 (190-246)||(10685936-10685992)
chr1 (196-252)||(4772193-4772249)
chr1 (194-246)||(4772621-4772673)
chr1 (192-254)||(4030726-4030788)
chr1 (190-232)||(10686685-10686727)
chr1 (191-232)||(48352311-48352352)
chr1 (190-252)||(27351133-27351204)
chr1 (178-211)||(44963971-44964004)
chr1 (151-183)||(34254545-34254577)
[»] chr5 (21 HSPs)
chr5 (147-230)||(6336255-6336338)
chr5 (193-252)||(36417968-36418027)
chr5 (193-246)||(35190001-35190054)
chr5 (190-246)||(26275979-26276035)
chr5 (193-254)||(38082636-38082697)
chr5 (147-215)||(32660371-32660439)
chr5 (190-232)||(36418371-36418413)
chr5 (190-240)||(38405518-38405568)
chr5 (192-232)||(20729017-20729057)
chr5 (194-253)||(26275585-26275644)
chr5 (192-254)||(5734954-5735024)
chr5 (190-235)||(13538572-13538617)
chr5 (149-184)||(6336188-6336223)
chr5 (183-229)||(32459819-32459865)
chr5 (222-252)||(32660281-32660311)
chr5 (190-252)||(35190393-35190454)
chr5 (194-254)||(18249038-18249107)
chr5 (151-184)||(18951348-18951381)
chr5 (222-254)||(18951323-18951355)
chr5 (222-254)||(18951383-18951415)
chr5 (222-254)||(20728608-20728640)
[»] scaffold0381 (1 HSPs)
scaffold0381 (18-121)||(6939-7042)
[»] scaffold0746 (1 HSPs)
scaffold0746 (193-232)||(509-548)
[»] scaffold0070 (2 HSPs)
scaffold0070 (193-232)||(28655-28694)
scaffold0070 (193-245)||(29033-29084)
[»] scaffold0374 (1 HSPs)
scaffold0374 (190-232)||(16224-16266)


Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 24)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 21813478 - 21813225
Alignment:
1 aatgcagcgcttactagctcaagatgatgcatattggcgtcaacgtgccaagactcattggtaccgggatggagactgcaacacaaaatttttccatgca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21813478 aatgcagcgcttactagctcaagatgatgcatattggcgtcaacgtgccaagactcattggtaccgggatggagactgcaacacaaaatttttccatgca 21813379  T
101 tcagccaccgctaggaagaagttaaattgtattattttttcaacagagtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21813378 tcagccaccgctaggaagaagttaaattgtattattttttcaacagagtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaata 21813279  T
201 gtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21813278 gtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 21813225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 147 - 232
Target Start/End: Original strand, 31264087 - 31264172
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||    
31264087 agtttcaaactaaaaggacctatttgaaacttttgaaagggtgacggtgaaatagtttatcaactaaaaggacctatttgaaactt 31264172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 149 - 254
Target Start/End: Original strand, 41265183 - 41265289
Alignment:
149 tttcaaactaaaaggacctatttaaaacttttgaaatggtgac-ggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttga 247  Q
    ||||||||||||||||| ||||| |||| ||||||| | |||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||    
41265183 tttcaaactaaaaggacatatttgaaacatttgaaacgatgaccggtgaaatagtttatcaactaaaatgacttatttgaaacttaaaggactaacttga 41265282  T
248 gaattct 254  Q
    |||||||    
41265283 gaattct 41265289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 248 - 299
Target Start/End: Complemental strand, 21813525 - 21813474
Alignment:
248 gaattcttcaggtgatgccaagttcagatgttttaattacggaagagaatgc 299  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
21813525 gaattcttcaggtgatgccaagttcagatgttttaattacggaagagaatgc 21813474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 151 - 245
Target Start/End: Complemental strand, 39376355 - 39376262
Alignment:
151 tcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaactt 245  Q
    |||||||||||||| |||||| ||||||||||||   ||| |||||||||||||||||||||||| ||| | ||||||| ||||| |||||||||    
39376355 tcaaactaaaaggatctatttgaaacttttgaaacaatgatggtgaaatagtttatcaactaaaaagacttatttgaaatttaaa-gactaactt 39376262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 27893174 - 27893117
Alignment:
194 tgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaat 251  Q
    |||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||    
27893174 tgaaatagtttatcaactaaaaagacctatttgaaacttaaaggactaacttgggaat 27893117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 163 - 254
Target Start/End: Complemental strand, 34336214 - 34336114
Alignment:
163 gacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacct---------ttttgaaacttaaaggactaacttgagaattc 253  Q
    ||||||||| |||||||||||| ||||| ||||||||||||||| |||||||| |||||         ||||||||||||||||||||||||| ||||||    
34336214 gacctatttgaaacttttgaaacggtgatggtgaaatagtttattaactaaaaagacctatttaaaacttttgaaacttaaaggactaacttgggaattc 34336115  T
254 t 254  Q
    |    
34336114 t 34336114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 147 - 255
Target Start/End: Original strand, 30907245 - 30907359
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatca------actaaaaggacctttttgaaacttaaaggact 240  Q
    ||||||||||||||||||| ||||| |||||||||||| |||||||| |||||| |||||||      ||| |   ||   |||||||||||||||||||    
30907245 agtttcaaactaaaaggacatatttgaaacttttgaaacggtgacggcgaaataatttatcataaatgacttatttgaaacttttgaaacttaaaggact 30907344  T
241 aacttgagaattctt 255  Q
    |||||||||||||||    
30907345 aacttgagaattctt 30907359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 190 - 252
Target Start/End: Original strand, 20535934 - 20535996
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaatt 252  Q
    |||||||||||||||||||||||| | ||| | ||||||||||||| ||||||||||||||||    
20535934 acggtgaaatagtttatcaactaacaagacttatttgaaacttaaaagactaacttgagaatt 20535996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 232
Target Start/End: Complemental strand, 19080781 - 19080739
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||||||||| | ||||||||    
19080781 acggtgaaatagtttatcaactaaaaggacctatatgaaactt 19080739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 232
Target Start/End: Original strand, 36196475 - 36196517
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||| ||||| ||||||||||    
36196475 acggtgaaatagtttatcaactaaaatgacctatttgaaactt 36196517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 193 - 254
Target Start/End: Original strand, 39301807 - 39301868
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||||||| | ||| |||||||||||||| | |||||| | ||||||    
39301807 gtgaaatagtttatcaactaaaatggcctatttgaaacttaaagaaataacttaaaaattct 39301868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 190 - 230
Target Start/End: Complemental strand, 20535595 - 20535555
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaac 230  Q
    |||||||||||||||||||||||||| ||||| ||||||||    
20535595 acggtgaaatagtttatcaactaaaatgacctatttgaaac 20535555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 254
Target Start/End: Complemental strand, 31264036 - 31264004
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||||||||||||||||    
31264036 ttttgaaacttaaaggactaacttgagaattct 31264004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 154 - 232
Target Start/End: Original strand, 5117014 - 5117092
Alignment:
154 aactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||| ||| ||||| ||  |||||||| ||||| ||||||||| |||||||||||||| ||| | ||| ||||||    
5117014 aactaaaatgacttatttgaaggttttgaaacggtgatggtgaaataatttatcaactaaaaagacatatttaaaactt 5117092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 222 - 252
Target Start/End: Complemental strand, 30907185 - 30907155
Alignment:
222 ttttgaaacttaaaggactaacttgagaatt 252  Q
    |||||||||||||||||||||||||||||||    
30907185 ttttgaaacttaaaggactaacttgagaatt 30907155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 208 - 246
Target Start/End: Complemental strand, 37543072 - 37543034
Alignment:
208 aactaaaaggacctttttgaaacttaaaggactaacttg 246  Q
    |||||||| ||||| ||||||||||||||||||||||||    
37543072 aactaaaatgacctgtttgaaacttaaaggactaacttg 37543034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 232
Target Start/End: Original strand, 42117178 - 42117220
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||| ||||||||||||||||||||| ||| ||||||    
42117178 acggtgaaattgtttatcaactaaaaggacctatttaaaactt 42117220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 154 - 184
Target Start/End: Original strand, 42117196 - 42117226
Alignment:
154 aactaaaaggacctatttaaaacttttgaaa 184  Q
    |||||||||||||||||||||||||||||||    
42117196 aactaaaaggacctatttaaaacttttgaaa 42117226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 147 - 208
Target Start/End: Original strand, 16780981 - 16781042
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatca 208  Q
    ||||||||| ||||||||| ||||| ||||||||||||  |||| ||| |||||||| ||||    
16780981 agtttcaaattaaaaggacttatttgaaacttttgaaacagtgatggtaaaatagttcatca 16781042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Original strand, 11871763 - 11871795
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||||||| |||||||||    
11871763 ttttgaaacttaaaggactaactcgagaattct 11871795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 192 - 232
Target Start/End: Original strand, 15506478 - 15506518
Alignment:
192 ggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||||| | ||| ||||||    
15506478 ggtgaaatagtttatcaactaaaaggacatatttaaaactt 15506518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Original strand, 27893573 - 27893605
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||||||||| |||||||    
27893573 ttttgaaacttaaaggactaacttgggaattct 27893605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 117
Target Start/End: Original strand, 45010899 - 45010999
Alignment:
17 gctcaagatgatgcatattggcgtcaacgtgccaagactcattggtaccgggatggagactgcaacacaaaatttttccatgcatcagccaccgctagga 116  Q
    ||||| |||||||| | |||||| |||| ||| || |||||||||||  |||| || ||| | |||||||| ||||| ||||| ||||| || |||||||    
45010899 gctcaggatgatgctttttggcggcaacatgctaaaactcattggtatagggacggtgaccgtaacacaaagttttttcatgcttcagctacggctagga 45010998  T
117 a 117  Q
    |    
45010999 a 45010999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 84; Significance: 6e-40; HSPs: 21)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 147 - 246
Target Start/End: Complemental strand, 16168652 - 16168553
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttg 246  Q
    ||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
16168652 agtttcaaactaaaaggacctatttgaaacttttgaaacggtgagggtgaaatagtttatcaactaaaaggacctatttgaaacttaaaggactaacttg 16168553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 147 - 232
Target Start/End: Complemental strand, 20575609 - 20575523
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtg-aaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||| ||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| ||| ||||| ||||||||||    
20575609 agtttcaaattaaaaggacctatttgaaacttttgaaatggtgacggtgaaaatagtttatcaactgaaatgacctatttgaaactt 20575523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 153 - 232
Target Start/End: Original strand, 32417647 - 32417726
Alignment:
153 aaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||| ||| ||||| |||||||||||| | |||||||||||||||||||||||||||||||||| ||||||||||    
32417647 aaactaaaatgacatatttgaaacttttgaaacgatgacggtgaaatagtttatcaactaaaaggacctatttgaaactt 32417726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 153 - 232
Target Start/End: Original strand, 32423488 - 32423567
Alignment:
153 aaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||| ||| ||||| |||||||||||| | |||||||||||||||||||||||||||||||||| ||||||||||    
32423488 aaactaaaatgacatatttgaaacttttgaaacgatgacggtgaaatagtttatcaactaaaaggacctatttgaaactt 32423567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 190 - 252
Target Start/End: Complemental strand, 11527680 - 11527618
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaatt 252  Q
    |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||    
11527680 acggtgaaatagtttatcaactaaaatgacctatttgaaacttaaaggactaacttgtgaatt 11527618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 190 - 254
Target Start/End: Original strand, 2840032 - 2840096
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||||||||| ||||| ||||||||||||| || |||||||||||||||    
2840032 acggtgaaatagtttatcaactaaaatgacctatttgaaacttaaatgattaacttgagaattct 2840096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 194 - 254
Target Start/End: Complemental strand, 2839765 - 2839705
Alignment:
194 tgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||||||  |||| ||||||| ||||||||||||||||||||||||    
2839765 tgaaatagtttatcaactaaaaaaacctatttgaaatttaaaggactaacttgagaattct 2839705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 190 - 242
Target Start/End: Original strand, 9946685 - 9946737
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaa 242  Q
    |||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
9946685 acggtgaaatagtttatcaactaaaaggacctctttgaaatttaaaggactaa 9946737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 192 - 254
Target Start/End: Original strand, 28630599 - 28630661
Alignment:
192 ggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||||||||||||| |||||| ||||||| ||||||||  |||||||    
28630599 ggtgaaatagtttatcaactaaaaggacctatttgaagcttaaagtactaacttaggaattct 28630661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 190 - 232
Target Start/End: Original strand, 10862558 - 10862600
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||||||||| ||||||||||    
10862558 acggtgaaatagtttatcaactaaaaggacctatttgaaactt 10862600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 99
Target Start/End: Original strand, 20927264 - 20927361
Alignment:
2 atgcagcgcttactagctcaagatgatgcatattggcgtcaacgtgccaagactcattggtaccgggatggagactgcaacacaaaatttttccatgc 99  Q
    |||||||| ||| || ||||||||| ||| || |||||||||||||  ||||| ||||||||   ||||||||||  |||||| ||||||||||||||    
20927264 atgcagcgtttattatctcaagatgttgcttactggcgtcaacgtggaaagacccattggtagaaggatggagacaacaacaccaaatttttccatgc 20927361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 192 - 245
Target Start/End: Complemental strand, 24139140 - 24139087
Alignment:
192 ggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaactt 245  Q
    ||||||||| |||||||||||||| ||| ||||||||||||||| || ||||||    
24139140 ggtgaaataatttatcaactaaaatgacatttttgaaacttaaatgattaactt 24139087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 133
Target Start/End: Original strand, 26904544 - 26904657
Alignment:
20 caagatgatgcatattggcgtcaacgtgccaagactcattggtaccgggatggagactgcaacacaaaatttttccatgcatcagccaccgctaggaaga 119  Q
    ||||||||||| |||||||| |||||||| |||||||||||||||  |||||| ||  | || |||||||| || |||| ||| ||  | ||| ||||||    
26904544 caagatgatgcctattggcgacaacgtgctaagactcattggtacaaggatggtgatcgaaatacaaaattctttcatgtatctgcttcagcttggaaga 26904643  T
120 agttaaattgtatt 133  Q
    || ||||| |||||    
26904644 aggtaaatcgtatt 26904657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 232
Target Start/End: Original strand, 17180110 - 17180152
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||| || || ||||||||||    
17180110 acggtgaaatagtttatcaactaaaatgatctatttgaaactt 17180152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 255
Target Start/End: Complemental strand, 2839677 - 2839644
Alignment:
222 ttttgaaacttaaaggactaacttgagaattctt 255  Q
    |||||||||||||| |||||||||||||||||||    
2839677 ttttgaaacttaaacgactaacttgagaattctt 2839644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 184
Target Start/End: Complemental strand, 20575490 - 20575457
Alignment:
151 tcaaactaaaaggacctatttaaaacttttgaaa 184  Q
    ||||||||||||||||||||||||||||| ||||    
20575490 tcaaactaaaaggacctatttaaaactttcgaaa 20575457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 184
Target Start/End: Complemental strand, 32417607 - 32417574
Alignment:
151 tcaaactaaaaggacctatttaaaacttttgaaa 184  Q
    ||||||||||||||| ||||||||||||||||||    
32417607 tcaaactaaaaggacatatttaaaacttttgaaa 32417574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 184
Target Start/End: Complemental strand, 32423448 - 32423415
Alignment:
151 tcaaactaaaaggacctatttaaaacttttgaaa 184  Q
    ||||||||||||||| ||||||||||||||||||    
32423448 tcaaactaaaaggacatatttaaaacttttgaaa 32423415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 185
Target Start/End: Original strand, 10963161 - 10963193
Alignment:
153 aaactaaaaggacctatttaaaacttttgaaat 185  Q
    ||||||||| |||||||||||||||||||||||    
10963161 aaactaaaatgacctatttaaaacttttgaaat 10963193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Original strand, 17132227 - 17132259
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||| |||||||||||||||    
17132227 ttttgaaacttaaaggattaacttgagaattct 17132259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Original strand, 20575609 - 20575641
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||||||||| |||||||    
20575609 ttttgaaacttaaaggactaacttgggaattct 20575641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 77; Significance: 9e-36; HSPs: 35)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 8865365 - 8865245
Alignment:
1 aatgcagcgcttactagctcaagatgatgcatattggcgtcaacgtgccaagactcattggtaccgggatggagactgcaacacaaaatttttccatgca 100  Q
    |||||||||||||||| |||| |||||||| |||||||||||||| ||||||||||||||||| || ||||||||| |||||||||| ||||| ||||||    
8865365 aatgcagcgcttactatctcaggatgatgcctattggcgtcaacgcgccaagactcattggtatcgtgatggagaccgcaacacaaatttttttcatgca 8865266  T
101 tcagccaccgctaggaagaag 121  Q
    ||| |||| ||||||||||||    
8865265 tcaaccactgctaggaagaag 8865245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 147 - 246
Target Start/End: Original strand, 36566450 - 36566549
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttg 246  Q
    ||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||| | ||||||||||||| ||||||||||    
36566450 agtttcaaactaaaaggacctatttgaaacttttgaaaaggtgacggtgaaatagtttatcaactaaaaagacatatttgaaacttaaaagactaacttg 36566549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 153 - 254
Target Start/End: Complemental strand, 31893431 - 31893330
Alignment:
153 aaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaatt 252  Q
    ||||||||||||||||||| |||||||||||| |||||| ||||||||||||||| ||||||| ||||| ||||||||||||| |||||||||  |||||    
31893431 aaactaaaaggacctatttgaaacttttgaaacggtgactgtgaaatagtttatcgactaaaatgacctatttgaaacttaaaagactaacttaggaatt 31893332  T
253 ct 254  Q
    ||    
31893331 ct 31893330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 147 - 232
Target Start/End: Original strand, 21413038 - 21413123
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||| ||| |||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||| ||||||||||    
21413038 agttttaaattaaaaggacctatttaaaacttttgaaacggtgacggtgaagtagtttatgaactaaaaggacctatttgaaactt 21413123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 147 - 215
Target Start/End: Complemental strand, 33879478 - 33879410
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaa 215  Q
    ||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||    
33879478 agtttcaaactaaaaggacctatttaaaacttttgaaacagtgacggtgaaatagtttatcaactaaaa 33879410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 147 - 232
Target Start/End: Original strand, 4187618 - 4187703
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||| ||| ||||| |||||||||||||||||| |||||||||||||||||||||||| ||||| ||| ||||||    
4187618 agtttcaaactaaaatgacttatttgaaacttttgaaatggtgaaggtgaaatagtttatcaactaaaatgacctatttaaaactt 4187703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 153 - 232
Target Start/End: Original strand, 19925272 - 19925351
Alignment:
153 aaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||| ||||||||| ||||||||||||  |||| |||||||||||||||||||| ||||||||| ||||||||||    
19925272 aaactaaaaagacctatttgaaacttttgaaacagtgatggtgaaatagtttatcaactgaaaggacctatttgaaactt 19925351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 193 - 254
Target Start/End: Original strand, 1441416 - 1441477
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||    
1441416 gtgaaatagtttatcaactaaaaggacctatttgaaacttaaaagactaacttgggaattct 1441477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 147 - 232
Target Start/End: Complemental strand, 34951423 - 34951338
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||  |||||||| ||||||||||||  ||||| ||||||||||||||||||||||| ||| | ||||||||||    
34951423 agtttcaaactaaaaaaacctatttgaaacttttgaaacagtgacagtgaaatagtttatcaactaaaatgacttatttgaaactt 34951338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 190 - 246
Target Start/End: Original strand, 8040127 - 8040183
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttg 246  Q
    |||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||    
8040127 acggtgaaatagttcatcaactaaaaggacctatttgaaacttaaaggactaacttg 8040183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 39958829 - 39958783
Alignment:
192 ggtgaaatagtttatcaactaaaaggacctttttgaaacttaaagga 238  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||    
39958829 ggtgaaatagtttatcaactaaaaggacctatttgaaacttaaagga 39958783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 190 - 254
Target Start/End: Original strand, 5559599 - 5559662
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||| ||||||||||| ||| | |||||||||||||||||||||||| |||||||    
5559599 acggtgaaatagtt-atcaactaaaaagacttatttgaaacttaaaggactaacttgggaattct 5559662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 17245582 - 17245498
Alignment:
18 ctcaagatgatgcatattggcgtcaacgtgccaagactcattggtaccgggatggagactgcaacacaaaatttttccatgcatc 102  Q
    ||||||||||||| |||||||| |||||||| |||||||||||||||  |||||| ||  | ||||| |||||||| ||||||||    
17245582 ctcaagatgatgcttattggcggcaacgtgcaaagactcattggtacaaggatggcgatagaaacaccaaattttttcatgcatc 17245498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 190 - 232
Target Start/End: Complemental strand, 5559262 - 5559220
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||||||||| ||||||||||    
5559262 acggtgaaatagtttatcaactaaaaggacctatttgaaactt 5559220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 190 - 232
Target Start/End: Complemental strand, 8039799 - 8039757
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||||||||| ||||||||||    
8039799 acggtgaaatagtttatcaactaaaaggacctatttgaaactt 8039757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 190 - 232
Target Start/End: Complemental strand, 10619953 - 10619911
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||||||||| ||||||||||    
10619953 acggtgaaatagtttatcaactaaaaggacctatttgaaactt 10619911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 208 - 254
Target Start/End: Original strand, 31893474 - 31893520
Alignment:
208 aactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||| | ||||||||||||||||||||||||||||||||    
31893474 aactaaaaggacttatttgaaacttaaaggactaacttgagaattct 31893520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 190 - 231
Target Start/End: Complemental strand, 20366200 - 20366159
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaact 231  Q
    |||||||||||||||||||||||||| ||||| |||||||||    
20366200 acggtgaaatagtttatcaactaaaaagacctatttgaaact 20366159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 191 - 252
Target Start/End: Original strand, 28256918 - 28256979
Alignment:
191 cggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaatt 252  Q
    |||||||||| ||||||||||||||  || | ||| ||||||||||||||||||||| ||||    
28256918 cggtgaaataatttatcaactaaaataacatatttaaaacttaaaggactaacttgaaaatt 28256979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 190 - 254
Target Start/End: Complemental strand, 35214960 - 35214887
Alignment:
190 acggtgaaatagtttatcaactaaaaggacc---------tttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||||||||| ||||         ||||||||||||||| ||||||||||||||||||    
35214960 acggtgaaatagtttatcaactaaaaagacctatttgaaatttttgaaacttaaaagactaacttgagaattct 35214887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 190 - 254
Target Start/End: Original strand, 42990989 - 42991052
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||||||||| ||||| ||| ||| ||||| || |||||||| ||||||    
42990989 acggtgaaatagtttatcaactaaaaagacctatttaaaatttaaa-gattaacttgaaaattct 42991052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 193 - 232
Target Start/End: Complemental strand, 28256643 - 28256604
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||| |||| ||||||||||    
28256643 gtgaaatagtttatcaactaaaagaacctatttgaaactt 28256604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 232
Target Start/End: Original strand, 1349120 - 1349162
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||| ||||||||||||||| ||||| ||||||||||    
1349120 acggtgaaatggtttatcaactaaaatgacctatttgaaactt 1349162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 232
Target Start/End: Original strand, 27995551 - 27995593
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||||||||||||||||| || ||| ||||||    
27995551 acggtgaaatagtttatcaactaaaaggatctatttaaaactt 27995593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 222 - 252
Target Start/End: Original strand, 31893437 - 31893467
Alignment:
222 ttttgaaacttaaaggactaacttgagaatt 252  Q
    |||||||||||||||||||||||||||||||    
31893437 ttttgaaacttaaaggactaacttgagaatt 31893467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 232
Target Start/End: Complemental strand, 33235183 - 33235145
Alignment:
194 tgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||| ||||| ||||||||||    
33235183 tgaaatagtttatcaactaaaatgacctctttgaaactt 33235145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 232
Target Start/End: Original strand, 39959165 - 39959207
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||| |||||| |||| ||||||||||    
39959165 acggtgaaatagtttatcaagtaaaagaacctatttgaaactt 39959207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 254
Target Start/End: Complemental strand, 5805086 - 5805058
Alignment:
226 gaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||||||||||||    
5805086 gaaacttaaaggactaacttgagaattct 5805058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 248 - 299
Target Start/End: Complemental strand, 8865413 - 8865361
Alignment:
248 gaattcttcaggtgatgcc-aagttcagatgttttaattacggaagagaatgc 299  Q
    |||||||||||||||||   |||||||||||||| ||||||| ||||||||||    
8865413 gaattcttcaggtgatggataagttcagatgtttgaattacgcaagagaatgc 8865361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 190 - 246
Target Start/End: Original strand, 10620206 - 10620262
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttg 246  Q
    |||||| |||| ||||||||||||||  || | |||||||||||||||||| |||||    
10620206 acggtggaataatttatcaactaaaataacttatttgaaacttaaaggacttacttg 10620262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Original strand, 19925350 - 19925382
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||||||||| |||||||    
19925350 ttttgaaacttaaaggactaacttgggaattct 19925382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 254
Target Start/End: Complemental strand, 20366096 - 20366068
Alignment:
226 gaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||||||||||||    
20366096 gaaacttaaaggactaacttgagaattct 20366068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Complemental strand, 21412978 - 21412946
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||||||||| ||||||    
21412978 ttttgaaacttaaaggactaacttgaaaattct 21412946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Complemental strand, 21413038 - 21413006
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||| ||||||||||||||||||    
21413038 ttttgaaacttaaaagactaacttgagaattct 21413006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Complemental strand, 27995173 - 27995141
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||| |||||||||||||||    
27995173 ttttgaaacttaaaggattaacttgagaattct 27995141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 25)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 147 - 232
Target Start/End: Original strand, 26329875 - 26329960
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||    
26329875 agtttcaaactaaaaggacttatttgaaacttttgaaatggtgacagtgaaatagtttatcaactaaaatgacctatttgaaactt 26329960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 147 - 232
Target Start/End: Complemental strand, 22025249 - 22025164
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||| |||||| |||||||||||| ||| ||||||||||||||||||||||||||| |||| ||||||||||    
22025249 agtttcaaactaaaaggagctatttgaaacttttgaaacggttacggtgaaatagtttatcaactaaaagaacctatttgaaactt 22025164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 147 - 221
Target Start/End: Original strand, 36890575 - 36890649
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacct 221  Q
    ||||||||||||||| ||| ||||| |||||||||||| |||||||||||||||||||||||||||||| |||||    
36890575 agtttcaaactaaaatgacatatttgaaacttttgaaacggtgacggtgaaatagtttatcaactaaaatgacct 36890649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 147 - 232
Target Start/End: Complemental strand, 43098373 - 43098289
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||| || |||||| |||||||||||  |||||  ||||||||||||||||||||||||||| | ||||||||||    
43098373 agtttcaaactaaaatgatctatttgaaacttttgaac-ggtgatcgtgaaatagtttatcaactaaaaggacttatttgaaactt 43098289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 252
Target Start/End: Original strand, 44916294 - 44916353
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaatt 252  Q
    |||||||||||||||||||||||  |||| ||||||||||||||||||||||||| ||||    
44916294 gtgaaatagtttatcaactaaaataacctatttgaaacttaaaggactaacttgaaaatt 44916353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 203 - 254
Target Start/End: Original strand, 52866347 - 52866398
Alignment:
203 ttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||| |||||||||||||||||||||||||| |||||||    
52866347 ttatcaactaaaaggacatttttgaaacttaaaggactaacttgggaattct 52866398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 190 - 242
Target Start/End: Complemental strand, 19631911 - 19631859
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaa 242  Q
    ||||| |||||||||||||||||||| ||||| ||||||||||||||||||||    
19631911 acggtaaaatagtttatcaactaaaatgacctatttgaaacttaaaggactaa 19631859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 27012844 - 27012741
Alignment:
18 ctcaagatgatgcatattggcgtcaacgtgccaagactcattggtaccgggatggagactgcaacacaaaatttttccatgcatcagccaccgctaggaa 117  Q
    ||||||| ||||| |||||||| ||| | || |||||||||||||| || ||||| ||||| ||||| ||||| || |||||||| ||||| ||||| ||    
27012844 ctcaagaagatgcttattggcggcaatgcgctaagactcattggtatcgagatggcgactgaaacacgaaattatttcatgcatctgccactgctagaaa 27012745  T
118 gaag 121  Q
    ||||    
27012744 gaag 27012741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 194 - 241
Target Start/End: Complemental strand, 52866096 - 52866049
Alignment:
194 tgaaatagtttatcaactaaaaggacctttttgaaacttaaaggacta 241  Q
    |||||||||||||||||||||| ||||| |||||||||||||||||||    
52866096 tgaaatagtttatcaactaaaatgacctatttgaaacttaaaggacta 52866049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 218
Target Start/End: Original strand, 35023910 - 35023979
Alignment:
149 tttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaagga 218  Q
    ||||||| ||||| ||| ||||| ||| ||||||||| || ||| |||||||||||||||||||||||||    
35023910 tttcaaattaaaatgacatatttgaaatttttgaaatagttacgatgaaatagtttatcaactaaaagga 35023979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 13 - 99
Target Start/End: Original strand, 6613642 - 6613728
Alignment:
13 actagctcaagatgatgcatattggcgtcaacgtgccaagactcattggtaccgggatggagactgcaacacaaaatttttccatgc 99  Q
    ||||||||||||||||||||||||||||||| | || ||  || ||||||  || || |||||| | ||||||||||| ||||||||    
6613642 actagctcaagatgatgcatattggcgtcaaagagcgaaagcttattggtttcgtgacggagaccgtaacacaaaattcttccatgc 6613728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 252
Target Start/End: Original strand, 30543108 - 30543170
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaatt 252  Q
    |||||||||||||||||||| ||||| ||  | ||||||| ||||||||||||||||| ||||    
30543108 acggtgaaatagtttatcaattaaaatgatttatttgaaatttaaaggactaacttgataatt 30543170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 232
Target Start/End: Complemental strand, 31229408 - 31229366
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||||||||||||||| |||| ||||||||||    
31229408 acggtgaaatagtttatcaactaaaagaacctatttgaaactt 31229366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 190 - 254
Target Start/End: Original strand, 52183404 - 52183468
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||||| |||  || | ||||||||||||||||||  |||| |||||||    
52183404 acggtgaaatagtttatcaacttaaaaaacttatttgaaacttaaaggactggcttgggaattct 52183468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 232
Target Start/End: Complemental strand, 30542769 - 30542731
Alignment:
194 tgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||||||||||||| || ||||||||||    
30542769 tgaaatagtttatcaactaaaaggatctgtttgaaactt 30542731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 254
Target Start/End: Complemental strand, 2909288 - 2909255
Alignment:
221 tttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||| ||||||||||||||||||||||||    
2909288 tttttgaaatttaaaggactaacttgagaattct 2909255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 191 - 232
Target Start/End: Original strand, 8408832 - 8408873
Alignment:
191 cggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||||||||||| | ||||| ||||||||||    
8408832 cggtgaaatagtttatcaactaagatgacctatttgaaactt 8408873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 184
Target Start/End: Original strand, 26329993 - 26330026
Alignment:
151 tcaaactaaaaggacctatttaaaacttttgaaa 184  Q
    ||||||||||||||||||||| ||||||||||||    
26329993 tcaaactaaaaggacctatttgaaacttttgaaa 26330026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 184
Target Start/End: Complemental strand, 41735890 - 41735857
Alignment:
151 tcaaactaaaaggacctatttaaaacttttgaaa 184  Q
    ||||||||||||||||||||| ||||||||||||    
41735890 tcaaactaaaaggacctatttgaaacttttgaaa 41735857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Original strand, 2788987 - 2789019
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||||||||| ||||||    
2788987 ttttgaaacttaaaggactaacttgaaaattct 2789019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 192 - 228
Target Start/End: Complemental strand, 19681340 - 19681304
Alignment:
192 ggtgaaatagtttatcaactaaaaggacctttttgaa 228  Q
    |||||||||||||||||||||||| ||||| ||||||    
19681340 ggtgaaatagtttatcaactaaaatgacctatttgaa 19681304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Original strand, 26330019 - 26330051
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||||||||| |||||||    
26330019 ttttgaaacttaaaggactaacttgggaattct 26330051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Complemental strand, 31229367 - 31229335
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||| ||||||||||||||||||    
31229367 ttttgaaacttaaatgactaacttgagaattct 31229335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Complemental strand, 52181827 - 52181795
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||||||||| |||||||    
52181827 ttttgaaacttaaaggactaacttgggaattct 52181795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Original strand, 52568207 - 52568239
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||| |||||||||||||    
52568207 ttttgaaacttaaaggactgacttgagaattct 52568239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 64; Significance: 5e-28; HSPs: 26)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 149 - 232
Target Start/End: Original strand, 9770725 - 9770808
Alignment:
149 tttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||| |||||| ||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||    
9770725 tttcaaactaaaaggatctatttgaaacttttgaaatagtgatggtgaaatagtttatcaactaaaaggacctatttgaaactt 9770808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 147 - 246
Target Start/End: Complemental strand, 11113737 - 11113638
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttg 246  Q
    ||||||||||||||| ||| ||||| || ||||||||| ||||||| ||||||||||||||||||||||  || | ||||||||||||||||||||||||    
11113737 agtttcaaactaaaatgacatatttgaagcttttgaaacggtgacgatgaaatagtttatcaactaaaataacttatttgaaacttaaaggactaacttg 11113638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 147 - 232
Target Start/End: Complemental strand, 36360096 - 36360011
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||||||  ||||| |||||||||||| ||||||||| |||||||||||||||||||| ||||| ||||||||||    
36360096 agtttcaaactaaaaggatttatttgaaacttttgaaacggtgacggtaaaatagtttatcaactaaaatgacctatttgaaactt 36360011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 196 - 252
Target Start/End: Original strand, 14871342 - 14871398
Alignment:
196 aaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaatt 252  Q
    |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||    
14871342 aaatagtttatcaactaaaaggacctatttgaaacttaaaggactaatttgagaatt 14871398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 149 - 229
Target Start/End: Complemental strand, 45017940 - 45017860
Alignment:
149 tttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaa 229  Q
    ||||||||||||| ||||||||| |||| ||||||| |||||||||||||||||||||||| ||||| ||| | |||||||    
45017940 tttcaaactaaaatgacctatttgaaacctttgaaacggtgacggtgaaatagtttatcaattaaaatgacttatttgaaa 45017860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 147 - 232
Target Start/End: Original strand, 29794196 - 29794280
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||| ||||| ||| ||||| |||| ||| ||| ||||||||||||||| ||||||||||||||||| || ||||||||||    
29794196 agtttcaaagtaaaaagacttatttgaaaccttt-aaacggtgacggtgaaataatttatcaactaaaaggatctatttgaaactt 29794280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 198 - 254
Target Start/End: Complemental strand, 23179122 - 23179066
Alignment:
198 atagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||| |||||  ||||||||||||||||||||||| |||||||    
23179122 atagtttatcaactaaaacgacctacttgaaacttaaaggactaacttgggaattct 23179066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 190 - 254
Target Start/End: Original strand, 40553228 - 40553292
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||| ||||| || || ||||||||||||| || |||||||||||||||    
40553228 acggtgaaatagtttatcaagtaaaatgatctatttgaaacttaaatgattaacttgagaattct 40553292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 208 - 254
Target Start/End: Complemental strand, 9770686 - 9770640
Alignment:
208 aactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||| ||||||||||||| ||||||||||||||||||    
9770686 aactaaaaggacctatttgaaacttaaatgactaacttgagaattct 9770640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 133
Target Start/End: Complemental strand, 43221159 - 43221046
Alignment:
20 caagatgatgcatattggcgtcaacgtgccaagactcattggtaccgggatggagactgcaacacaaaatttttccatgcatcagccaccgctaggaaga 119  Q
    ||||||||||  |||||||||||||| || || || ||||||||||| |||||||||   || || |||||||| ||||||||||  || |||||||| |    
43221159 caagatgatgtgtattggcgtcaacgggcaaaaacccattggtaccgagatggagaccaaaatacgaaattttttcatgcatcagttactgctaggaaaa 43221060  T
120 agttaaattgtatt 133  Q
    || ||||| |||||    
43221059 aggtaaatcgtatt 43221046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 232
Target Start/End: Complemental strand, 9276632 - 9276593
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||||||||||||||||| ||||||||||    
9276632 gtgaaatagtttatcaactaaaaggacctatttgaaactt 9276593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 232
Target Start/End: Complemental strand, 23553507 - 23553465
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||| ||||| ||||||||||    
23553507 acggtgaaatagtttatcaactaaaatgacctatttgaaactt 23553465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 232
Target Start/End: Original strand, 34686878 - 34686920
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||||||||| ||| ||||||    
34686878 acggtgaaatagtttatcaactaaaaggacctatttaaaactt 34686920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 194 - 246
Target Start/End: Original strand, 6236222 - 6236274
Alignment:
194 tgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttg 246  Q
    ||||||||||| |||| ||||| ||||| |||||||||||||| |||||||||    
6236222 tgaaatagtttttcaattaaaatgacctatttgaaacttaaagtactaacttg 6236274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 154 - 184
Target Start/End: Complemental strand, 5358717 - 5358687
Alignment:
154 aactaaaaggacctatttaaaacttttgaaa 184  Q
    |||||||||||||||||||||||||||||||    
5358717 aactaaaaggacctatttaaaacttttgaaa 5358687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 222 - 252
Target Start/End: Complemental strand, 8713897 - 8713867
Alignment:
222 ttttgaaacttaaaggactaacttgagaatt 252  Q
    |||||||||||||||||||||||||||||||    
8713897 ttttgaaacttaaaggactaacttgagaatt 8713867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 232
Target Start/End: Original strand, 9276965 - 9277006
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||| ||||| ||||||||||    
9276965 acggtgaaatagtttatcaactaaaa-gacctatttgaaactt 9277006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 232
Target Start/End: Original strand, 16208674 - 16208712
Alignment:
194 tgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||| | ||||||||||    
16208674 tgaaatagtttatcaactaaaaggacatatttgaaactt 16208712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 232
Target Start/End: Complemental strand, 39701037 - 39700995
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||| ||| | ||||||||||    
39701037 acggtgaaatagtttatcaactaaaatgacatatttgaaactt 39700995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 195 - 232
Target Start/End: Complemental strand, 5358730 - 5358693
Alignment:
195 gaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||||||||||||||| ||| ||||||    
5358730 gaaatagtttatcaactaaaaggacctatttaaaactt 5358693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 254
Target Start/End: Original strand, 30576640 - 30576713
Alignment:
190 acggtgaaatagtttatcaactaaaaggacct---------ttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||||||||| ||| |         ||||||||||||||||||||||||| |||||||    
30576640 acggtgaaatagtttatcaactaaaatgacatatttaaaacttttgaaacttaaaggactaacttgggaattct 30576713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 192 - 232
Target Start/End: Complemental strand, 13771508 - 13771468
Alignment:
192 ggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||||||||||||| | || ||||||||||    
13771508 ggtgaaatagtttatcaactaaaagaatctatttgaaactt 13771468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Original strand, 25730144 - 25730176
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||| ||||||||||||||||||||||||    
25730144 ttttgaaatttaaaggactaacttgagaattct 25730176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Original strand, 25737630 - 25737662
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||| ||||||||||||||||||||||||    
25737630 ttttgaaatttaaaggactaacttgagaattct 25737662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 229
Target Start/End: Original strand, 39701376 - 39701412
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaa 229  Q
    ||||| ||||||||||||||||||||||| |||||||    
39701376 gtgaagtagtttatcaactaaaaggacctatttgaaa 39701412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Original strand, 39701474 - 39701506
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||| |||||||||||||||||    
39701474 ttttgaaacttaaagaactaacttgagaattct 39701506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0027 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: scaffold0027
Description:

Target: scaffold0027; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 193 - 254
Target Start/End: Complemental strand, 9535 - 9474
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||    
9535 gtgaaatagtttatcaactaaaaggacctatttgaaacttaaagaactaacttgagaattct 9474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: scaffold0019
Description:

Target: scaffold0019; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 147 - 220
Target Start/End: Original strand, 124254 - 124327
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacc 220  Q
    ||||||||||||||| ||||||||| ||| |||||||| ||||| |||||||||||||||||||||||||||||    
124254 agtttcaaactaaaatgacctatttgaaatttttgaaacggtgatggtgaaatagtttatcaactaaaaggacc 124327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 54; Significance: 5e-22; HSPs: 12)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 147 - 232
Target Start/End: Complemental strand, 54456807 - 54456722
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||| ||| ||||| |||||||||||| |||||||||||| ||||||||||||||||| ||| | ||||||||||    
54456807 agtttcaaactaaaaagacttatttgaaacttttgaaacggtgacggtgaattagtttatcaactaaaatgacatatttgaaactt 54456722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 190 - 254
Target Start/End: Complemental strand, 14629369 - 14629305
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||| ||||||||||||||| |||| |||||||||||||||||||||||| |||||||    
14629369 acggtgaaataatttatcaactaaaagaacctatttgaaacttaaaggactaacttgggaattct 14629305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 191 - 254
Target Start/End: Original strand, 4276597 - 4276660
Alignment:
191 cggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||||||||| || || |||||||||||||||||||||||| |||||||    
4276597 cggtgaaatagtttatcaactaaaatgatctatttgaaacttaaaggactaacttgggaattct 4276660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 190 - 244
Target Start/End: Original strand, 3088073 - 3088127
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaact 244  Q
    |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||    
3088073 acggtgaaatagtttatcaattaaaaggacctatttgaaacttaaaggactaact 3088127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 147 - 252
Target Start/End: Complemental strand, 5505700 - 5505595
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttg 246  Q
    |||||||||||||||| || ||||| |||||||| ||| | ||| ||||||| | |||||||||||||| ||||||||| |||| |||| || |||||||    
5505700 agtttcaaactaaaagaacttatttgaaactttttaaacgatgatggtgaaaaaatttatcaactaaaatgacctttttaaaacctaaatgagtaacttg 5505601  T
247 agaatt 252  Q
    | ||||    
5505600 aaaatt 5505595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 190 - 252
Target Start/End: Original strand, 35555954 - 35556016
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaatt 252  Q
    ||||||||||||||||| |||||||| ||||| |||||||||||||||| ||||||| |||||    
35555954 acggtgaaatagtttattaactaaaatgacctatttgaaacttaaaggattaacttgggaatt 35556016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 190 - 238
Target Start/End: Original strand, 21376990 - 21377038
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaagga 238  Q
    ||||||||||||||||| |||||||||||||| ||||||||||||||||    
21376990 acggtgaaatagtttataaactaaaaggacctatttgaaacttaaagga 21377038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 243
Target Start/End: Original strand, 33975069 - 33975120
Alignment:
192 ggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaac 243  Q
    ||||||||| ||||||||||||||| |||| |||||||||||||||||||||    
33975069 ggtgaaataatttatcaactaaaagaacctatttgaaacttaaaggactaac 33975120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 147 - 200
Target Start/End: Original strand, 14964776 - 14964829
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaata 200  Q
    |||||||||||||||||||| | || |||||||||||| |||||||||||||||    
14964776 agtttcaaactaaaaggaccaagttgaaacttttgaaacggtgacggtgaaata 14964829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 193 - 254
Target Start/End: Complemental strand, 50530386 - 50530326
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||| ||||| ||||| ||| |||||| |||||| || |||||||||||    
50530386 gtgaaatagtttatcaattaaaatgacctatttaaaactt-aaggacaaatttgagaattct 50530326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 35 - 123
Target Start/End: Original strand, 14478808 - 14478896
Alignment:
35 tggcgtcaacgtgccaagactcattggtaccgggatggagactgcaacacaaaatttttccatgcatcagccaccgctaggaagaagtt 123  Q
    ||||| |||||||| ||  |||||||||| || ||||| ||| | ||||| |||||||| || || |||||||| || |||||||||||    
14478808 tggcggcaacgtgctaaagctcattggtatcgagatggtgaccggaacacgaaattttttcacgcttcagccactgcaaggaagaagtt 14478896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 120
Target Start/End: Original strand, 44492146 - 44492246
Alignment:
20 caagatgatgcatattggcgtcaacgtgccaagactcattggtaccgggatggagactgcaacacaaaatttttccatgcatcagccaccgctaggaaga 119  Q
    ||||||||||| |||||||| || || || || || ||||||||  | ||||| | | | ||||| ||||| |||||||| || ||||||||||||||||    
44492146 caagatgatgcgtattggcgccagcgggctaaaacccattggtatagagatggtggccgtaacacgaaattcttccatgcctctgccaccgctaggaaga 44492245  T
120 a 120  Q
    |    
44492246 a 44492246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 54; Significance: 5e-22; HSPs: 14)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 147 - 232
Target Start/End: Complemental strand, 1765889 - 1765804
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||||||  ||||| |||||||||||  ||||||||||||||||||||||||||||||||| || ||| ||||||    
1765889 agtttcaaactaaaaggagatatttgaaacttttgaatcggtgacggtgaaatagtttatcaactaaaaggatctatttaaaactt 1765804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 193 - 254
Target Start/End: Original strand, 49650984 - 49651045
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||    
49650984 gtgaaatagtttatcaactaaagggacctatttgaaacttaaaggactaacttgagaattct 49651045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 2 - 137
Target Start/End: Original strand, 41329266 - 41329401
Alignment:
2 atgcagcgcttactagctcaagatgatgcatattggcgtcaacgtgccaagactcattggtaccgggatggagactgcaacacaaaatttttccatgcat 101  Q
    |||||||| ||| || ||||||||||||| || ||| |||||| ||| |||||||||| |||| |||||||||||  |||||| |||||||||||||| |    
41329266 atgcagcgtttattatctcaagatgatgcttactggtgtcaacctgcaaagactcattagtacagggatggagaccacaacaccaaatttttccatgctt 41329365  T
102 cagccaccgctaggaagaagttaaattgtattattt 137  Q
    | || || ||||| |||||| |||||  ||||||||    
41329366 ccgctacggctagaaagaaggtaaatcatattattt 41329401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 193 - 254
Target Start/End: Original strand, 27351518 - 27351579
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||| |||||| |||| |||||||||||||||||||| |||||||||||    
27351518 gtgaaatagtttatcaagtaaaagcacctatttgaaacttaaaggactaatttgagaattct 27351579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 254
Target Start/End: Complemental strand, 49650715 - 49650653
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaactt-aaaggactaacttgagaattct 254  Q
    ||||||| |||||||||||||||| |||| |||||||||| ||||||||||||||||||||||    
49650715 gtgaaatggtttatcaactaaaagaacctatttgaaacttaaaaggactaacttgagaattct 49650653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 190 - 246
Target Start/End: Complemental strand, 10685992 - 10685936
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttg 246  Q
    ||||| |||||||||||||||||||| ||| | ||||||||||||||||||||||||    
10685992 acggtaaaatagtttatcaactaaaatgacatatttgaaacttaaaggactaacttg 10685936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 196 - 252
Target Start/End: Complemental strand, 4772249 - 4772193
Alignment:
196 aaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaatt 252  Q
    ||||||||||||||||||||| || | ||||||||||||||||||| |||| |||||    
4772249 aaatagtttatcaactaaaagaacttatttgaaacttaaaggactaccttgtgaatt 4772193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 194 - 246
Target Start/End: Original strand, 4772621 - 4772673
Alignment:
194 tgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttg 246  Q
    ||||||||||||||||||||||| |  | ||||||||||||||||||||||||    
4772621 tgaaatagtttatcaactaaaagaatttatttgaaacttaaaggactaacttg 4772673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 254
Target Start/End: Original strand, 4030726 - 4030788
Alignment:
192 ggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||| ||||||||| ||||| |||||||||||| ||| || ||||| ||||||    
4030726 ggtgaaatagtttaccaactaaaatgacctatttgaaacttaagggattagcttgaaaattct 4030788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 232
Target Start/End: Original strand, 10686685 - 10686727
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||| ||||| ||||||||||    
10686685 acggtgaaatagtttatcaactaaaatgacctatttgaaactt 10686727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 191 - 232
Target Start/End: Complemental strand, 48352352 - 48352311
Alignment:
191 cggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||| |||| ||||||||||    
48352352 cggtgaaatagtttatcaactaaaagaacctatttgaaactt 48352311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 190 - 252
Target Start/End: Complemental strand, 27351204 - 27351133
Alignment:
190 acggtgaaatagtttatcaactaaaaggacct---------ttttgaaacttaaaggactaacttgagaatt 252  Q
    |||||||||||||||||||||||||| ||| |         |||||||||||||||||||||||||||||||    
27351204 acggtgaaatagtttatcaactaaaatgacttatttgatacttttgaaacttaaaggactaacttgagaatt 27351133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 211
Target Start/End: Complemental strand, 44964004 - 44963971
Alignment:
178 tttgaaatggtgacggtgaaatagtttatcaact 211  Q
    ||||||| ||||||||||||||||||||||||||    
44964004 tttgaaacggtgacggtgaaatagtttatcaact 44963971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 151 - 183
Target Start/End: Complemental strand, 34254577 - 34254545
Alignment:
151 tcaaactaaaaggacctatttaaaacttttgaa 183  Q
    |||||||||||||| ||||||||||||||||||    
34254577 tcaaactaaaaggatctatttaaaacttttgaa 34254545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 52; Significance: 8e-21; HSPs: 21)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 147 - 230
Target Start/End: Original strand, 6336255 - 6336338
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaac 230  Q
    ||||||||||  ||||||||||||| |||||||| ||| |||||||||||||||||||||||||| ||||||| | ||||||||    
6336255 agtttcaaacataaaggacctatttgaaacttttaaaacggtgacggtgaaatagtttatcaactgaaaggacatatttgaaac 6336338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 193 - 252
Target Start/End: Complemental strand, 36418027 - 36417968
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaatt 252  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||    
36418027 gtgaaataatttatcaactaaaaggacctatttgaaacttaaaggactaacttgagaatt 36417968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 193 - 246
Target Start/End: Complemental strand, 35190054 - 35190001
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttg 246  Q
    ||||||||||||||||||||||| || |||||||||||||||||||||||||||    
35190054 gtgaaatagtttatcaactaaaatgatctttttgaaacttaaaggactaacttg 35190001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 190 - 246
Target Start/End: Original strand, 26275979 - 26276035
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttg 246  Q
    |||||||||||| ||||||||||||||||| | ||||||||||||||||||||||||    
26275979 acggtgaaatagcttatcaactaaaaggacatatttgaaacttaaaggactaacttg 26276035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 193 - 254
Target Start/End: Complemental strand, 38082697 - 38082636
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||||||| ||||| ||| ||| ||||| ||||||||||||||||||    
38082697 gtgaaatagtttatcaactaaaatgacctatttaaaatttaaaagactaacttgagaattct 38082636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 147 - 215
Target Start/End: Original strand, 32660371 - 32660439
Alignment:
147 agtttcaaactaaaaggacctatttaaaacttttgaaatggtgacggtgaaatagtttatcaactaaaa 215  Q
    |||||||||||||| |||| ||||| |||||||| ||| ||||||  ||||||||||||||||||||||    
32660371 agtttcaaactaaatggacttatttgaaacttttaaaacggtgacactgaaatagtttatcaactaaaa 32660439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 190 - 232
Target Start/End: Original strand, 36418371 - 36418413
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||||||||| ||||||||||    
36418371 acggtgaaatagtttatcaactaaaaggacctatttgaaactt 36418413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 190 - 240
Target Start/End: Original strand, 38405518 - 38405568
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggact 240  Q
    |||||||||||||||||||||||||||||| | ||| ||||||||||||||    
38405518 acggtgaaatagtttatcaactaaaaggacatatttaaaacttaaaggact 38405568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 192 - 232
Target Start/End: Original strand, 20729017 - 20729057
Alignment:
192 ggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||||||| ||||||||||    
20729017 ggtgaaatagtttatcaactaaaaggacctatttgaaactt 20729057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 194 - 253
Target Start/End: Complemental strand, 26275644 - 26275585
Alignment:
194 tgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaattc 253  Q
    ||||||||||| ||||||||||| |||| |||||||||| || |||||||||| ||||||    
26275644 tgaaatagtttgtcaactaaaagaacctatttgaaacttgaatgactaacttgggaattc 26275585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 192 - 254
Target Start/End: Original strand, 5734954 - 5735024
Alignment:
192 ggtgaaatagtttatcaactaaaaggacctttttga--------aacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||||||| ||||| |||||        |||||||||||||||||||||||||||    
5734954 ggtgaaatagtttatcaactaaaatgacctatttgaaacttttgaacttaaaggactaacttgagaattct 5735024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 190 - 235
Target Start/End: Complemental strand, 13538617 - 13538572
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaa 235  Q
    |||||||||||||||||||||||||| ||| | |||||||||||||    
13538617 acggtgaaatagtttatcaactaaaatgacatatttgaaacttaaa 13538572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 149 - 184
Target Start/End: Complemental strand, 6336223 - 6336188
Alignment:
149 tttcaaactaaaaggacctatttaaaacttttgaaa 184  Q
    ||||||||||||| ||||||||||||||||||||||    
6336223 tttcaaactaaaatgacctatttaaaacttttgaaa 6336188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 229
Target Start/End: Original strand, 32459819 - 32459865
Alignment:
183 aatggtgacggtgaaatagtttatcaactaaaaggacctttttgaaa 229  Q
    |||||| || ||||||||||||||| ||||||||||||| |||||||    
32459819 aatggtaacagtgaaatagtttatcgactaaaaggacctatttgaaa 32459865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 222 - 252
Target Start/End: Complemental strand, 32660311 - 32660281
Alignment:
222 ttttgaaacttaaaggactaacttgagaatt 252  Q
    |||||||||||||||||||||||||||||||    
32660311 ttttgaaacttaaaggactaacttgagaatt 32660281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 252
Target Start/End: Original strand, 35190393 - 35190454
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaacttgagaatt 252  Q
    |||||||||||||||||||||||||| ||||   |||||||||||| ||| || |||||||||    
35190393 acggtgaaatagtttatcaactaaaaagacc-aattgaaacttaaaagacaaatttgagaatt 35190454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 194 - 254
Target Start/End: Complemental strand, 18249107 - 18249038
Alignment:
194 tgaaatagtttatcaactaaaaggacct---------ttttgaaacttaaaggactaacttgagaattct 254  Q
    |||||||||||||||||||||| |||||         |||||||||||||| ||||||||||||||||||    
18249107 tgaaatagtttatcaactaaaaagacctatttaaaacttttgaaacttaaatgactaacttgagaattct 18249038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 184
Target Start/End: Complemental strand, 18951381 - 18951348
Alignment:
151 tcaaactaaaaggacctatttaaaacttttgaaa 184  Q
    |||||||||||||| |||||||||||||||||||    
18951381 tcaaactaaaaggatctatttaaaacttttgaaa 18951348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Complemental strand, 18951355 - 18951323
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    ||||||||||||||||||||||||| |||||||    
18951355 ttttgaaacttaaaggactaacttgggaattct 18951323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Complemental strand, 18951415 - 18951383
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    |||| ||||||||||||||||||||||||||||    
18951415 ttttaaaacttaaaggactaacttgagaattct 18951383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Complemental strand, 20728640 - 20728608
Alignment:
222 ttttgaaacttaaaggactaacttgagaattct 254  Q
    |||| ||||||||||||||||||||||||||||    
20728640 ttttaaaacttaaaggactaacttgagaattct 20728608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0381 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0381
Description:

Target: scaffold0381; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 121
Target Start/End: Original strand, 6939 - 7042
Alignment:
18 ctcaagatgatgcatattggcgtcaacgtgccaagactcattggtaccgggatggagactgcaacacaaaatttttccatgcatcagccaccgctaggaa 117  Q
    ||||||| ||||| |||||||| ||| | || |||||||||||||| || ||||| ||||| ||||| ||||| || |||||||| ||||| ||||| ||    
6939 ctcaagaagatgcttattggcggcaatgcgctaagactcattggtatcgagatggcgactgaaacacgaaattatttcatgcatctgccactgctagaaa 7038  T
118 gaag 121  Q
    ||||    
7039 gaag 7042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0746 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0746
Description:

Target: scaffold0746; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 193 - 232
Target Start/End: Original strand, 509 - 548
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||||||||||| ||||| ||||||||||    
509 gtgaaatagtttatcaactaaaatgacctatttgaaactt 548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0070 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: scaffold0070
Description:

Target: scaffold0070; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 193 - 232
Target Start/End: Complemental strand, 28694 - 28655
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    ||||||||||||||||||||||| ||||| ||||||||||    
28694 gtgaaatagtttatcaactaaaatgacctatttgaaactt 28655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0070; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 245
Target Start/End: Original strand, 29033 - 29084
Alignment:
193 gtgaaatagtttatcaactaaaaggacctttttgaaacttaaaggactaactt 245  Q
    |||||||| |||||||||||||| ||| | ||||||||||||| |||||||||    
29033 gtgaaataatttatcaactaaaatgacatatttgaaacttaaa-gactaactt 29084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0374 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0374
Description:

Target: scaffold0374; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 232
Target Start/End: Complemental strand, 16266 - 16224
Alignment:
190 acggtgaaatagtttatcaactaaaaggacctttttgaaactt 232  Q
    |||||||||||||||||||||||||| ||||| ||| ||||||    
16266 acggtgaaatagtttatcaactaaaatgacctatttaaaactt 16224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175913 times since January 2019
Visitors: 1577