View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-54 (Length: 387)

Name: J5-6-54
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-54
J5-6-54
[»] chr6 (1 HSPs)
chr6 (1-383)||(3224647-3225029)
[»] chr7 (2 HSPs)
chr7 (221-362)||(2045640-2045781)
chr7 (1-83)||(2045439-2045521)


Alignment Details
Target: chr6 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 383
Target Start/End: Complemental strand, 3225029 - 3224647
Alignment:
1 aggatggtcttgttgatattatccaaggttctactggtatcacaatctcaaattgtcacatgacaaaacataatgatgtaagtnnnnnnntggctactat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||    
3225029 aggatggtcttgttgatattatccaaggttctactggtatcacaatctcaaattgtcacatgacaaaacataatgatgtaagtaaaaaaatggctactat 3224930  T
101 tgcatgatatattaattaatataaaatnnnnnnnntgaaattttatatgatatttaatttctgcnaaatgtatatacatggcctacnttacttaaaattt 200  Q
    |||||||||||||||||||||||||||        ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||    
3224929 tgcatgatatattaattaatataaaataaaaaaaatgaaattttatatgatatttaatttctgcaaaatgtatatacatggcctacattacttaaaattt 3224830  T
201 atgggtccgtctctgattgcaggttatgttatttggagctagtgattcatacnctggngacaagcttatgcnaataacagtagcattcaaccactttgga 300  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||||||||    
3224829 atgggtccgtctctgattgcaggttatgttatttggagctagtgattcatacactggtgacaagcttatgcaaataacagtagcattcaaccactttgga 3224730  T
301 caaggattgattcnaanaatgccnaggtgcngatatggttttgttcatgttttgaacaatgacnatacncnttggataatgta 383  Q
    ||||||||||||| || |||||| |||||| |||||||||||||||||||||||||||||||| |||| | ||||||||||||    
3224729 caaggattgattcaaagaatgccaaggtgcagatatggttttgttcatgttttgaacaatgactatactcattggataatgta 3224647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 362
Target Start/End: Original strand, 2045640 - 2045781
Alignment:
221 aggttatgttatttggagctagtgattcatacnctggngacaagcttatgcnaataacagtagcattcaaccactttggacaaggattgattcnaanaat 320  Q
    |||| ||||| ||||||||||||||| ||||    |  |||||| |||||| | | ||||| ||||||||||| || |||||||||||||||| || |||    
2045640 aggtgatgttgtttggagctagtgatacatatcaagatgacaagattatgcaagtcacagttgcattcaaccatttcggacaaggattgattcaaagaat 2045739  T
321 gccnaggtgcngatatggttttgttcatgttttgaacaatga 362  Q
    ||| || ||| |||  || ||| | |||||||||||||||||    
2045740 gccaagatgcagatggggatttttccatgttttgaacaatga 2045781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 2045439 - 2045521
Alignment:
1 aggatggtcttgttgatattatccaaggttctactggtatcacaatctcaaattgtcacatgacaaaacataatgatgtaagt 83  Q
    ||||||||||||||||| | || ||||| |||||||   |||| ||||||||||| |||||||| |||||||| |||||||||    
2045439 aggatggtcttgttgatgtcattcaaggctctactgcagtcaccatctcaaattgccacatgaccaaacataacgatgtaagt 2045521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 307234 times since January 2019
Visitors: 441