View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-55 (Length: 437)

Name: J5-6-55
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-55
J5-6-55
[»] chr1 (3 HSPs)
chr1 (63-342)||(23808086-23808365)
chr1 (336-437)||(23807928-23808028)
chr1 (69-155)||(11016967-11017054)
[»] chr5 (3 HSPs)
chr5 (75-177)||(29531854-29531955)
chr5 (70-179)||(30384189-30384297)
chr5 (63-156)||(38458808-38458899)
[»] chr4 (5 HSPs)
chr4 (130-183)||(31095352-31095405)
chr4 (63-126)||(49291321-49291383)
chr4 (80-155)||(53769786-53769861)
chr4 (76-158)||(49291274-49291356)
chr4 (66-94)||(2803423-2803451)
[»] chr7 (3 HSPs)
chr7 (66-156)||(6589561-6589651)
chr7 (78-180)||(12422023-12422125)
chr7 (66-156)||(30551950-30552040)
[»] chr8 (2 HSPs)
chr8 (69-174)||(15907953-15908058)
chr8 (130-174)||(12807704-12807748)
[»] chr2 (1 HSPs)
chr2 (67-156)||(6739652-6739740)
[»] chr6 (1 HSPs)
chr6 (70-178)||(10544024-10544131)


Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 63 - 342
Target Start/End: Original strand, 23808086 - 23808365
Alignment:
63 aatgaccaacttattacaattaaataacttaatagacctaactgatatgagaaaaactaaaaagaataatttattacaattaaacaacttaaaagatctt 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23808086 aatgaccaacttattacaattaaataacttaatagacctaactgatatgagaaaaactaaaaagaataatttattacaattaaacaacttaaaagatctt 23808185  T
163 tgatgtaatttaacctataatctacaatgtatatatgatgagttgtaagaacttaggatggtagcagagccagcctcatgaggctgccactaaagtaaag 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23808186 tgatgtaatttaacctataatctacaatgtatatatgatgagttgtaagaacttaggatggtagcagagccagcctcatgaggctgccactaaagtaaag 23808285  T
263 attttagacctcaattcttttggcttcatagtagcccccaaattttgtttgctttaagtatatgtcntaagtggaattct 342  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
23808286 attttagacctcaattcttttggcttcatagtagcccccaaattttgtttgctttaagtatatgtcttaagtggaattct 23808365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 336 - 437
Target Start/End: Original strand, 23807928 - 23808028
Alignment:
336 gaattctaactatcggtaagcctcataggacatgtggcaaagagatngaaaagaccaaaataactaactcaatcatcactaactccctaatcngtgtaac 435  Q
    ||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |||||||    
23807928 gaattctaactatcggtaagc-tcataggacatgtggcaaagagatagaaaagaccaaaataactaactcaatcatcactaactctctaatctgtgtaac 23808026  T
436 tt 437  Q
    ||    
23808027 tt 23808028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 69 - 155
Target Start/End: Original strand, 11016967 - 11017054
Alignment:
69 caacttattacaattaaataacttaatagacctaactgatatg-agaaaaactaaaaagaataatttattacaattaaacaacttaaa 155  Q
    |||||| ||||||||||||||||||| | |||||| ||||||| | ||||| ||| |||| |||||||||| ||||||| ||||||||    
11016967 caacttgttacaattaaataacttaaaacacctaagtgatatgcaaaaaaaataagaagattaatttattataattaaataacttaaa 11017054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 75 - 177
Target Start/End: Complemental strand, 29531955 - 29531854
Alignment:
75 attacaattaaataacttaatagacctaactgatatgagaaaaactaaaaagaataatttattacaattaaacaacttaaaagatctttgatgtaattta 174  Q
    ||||||||||||||||||||  ||| ||| ||||| || ||||||| ||| || |||||||||||||||||| |||||||| ||  | | ||||||||||    
29531955 attacaattaaataacttaaatgacgtaaatgatacga-aaaaacttaaaggactaatttattacaattaaataacttaaatgacatctcatgtaattta 29531857  T
175 acc 177  Q
    |||    
29531856 acc 29531854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 70 - 179
Target Start/End: Complemental strand, 30384297 - 30384189
Alignment:
70 aacttattacaattaaataacttaatagacctaactgatatgagaaaaactaaaaagaataatttattacaattaaacaacttaaaagatctttgatgta 169  Q
    ||||| ||||||||||||||||||| |||| ||| | ||| || ||||||| ||||||  ||||| ||||||||||| ||||||||  ||||  ||||||    
30384297 aacttgttacaattaaataacttaaaagacgtaagtaatacga-aaaaacttaaaagacaaatttgttacaattaaataacttaaagaatctccgatgta 30384199  T
170 atttaaccta 179  Q
    ||||| ||||    
30384198 atttagccta 30384189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 63 - 156
Target Start/End: Original strand, 38458808 - 38458899
Alignment:
63 aatgaccaacttattacaattaaataacttaatagacctaactgatatgagaaaaactaaaaagaataatttattacaattaaacaacttaaaa 156  Q
    |||||| ||||||||||||| ||||||||||| |||  ||| || || || ||||||| |||  | |||||||||||||||||| |||||||||    
38458808 aatgactaacttattacaataaaataacttaaaagatataagtggtacgaaaaaaacttaaa--actaatttattacaattaaataacttaaaa 38458899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000006; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 130 - 183
Target Start/End: Original strand, 31095352 - 31095405
Alignment:
130 aatttattacaattaaacaacttaaaagatctttgatgtaatttaacctataat 183  Q
    ||||||||||||||||| ||||||||  | |||||||||||| |||||||||||    
31095352 aatttattacaattaaataacttaaagaacctttgatgtaatctaacctataat 31095405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 63 - 126
Target Start/End: Original strand, 49291321 - 49291383
Alignment:
63 aatgaccaacttattacaattaaataacttaatagacctaactgatatgagaaaaactaaaaag 126  Q
    |||||| ||||| ||||||||||||||||||| |||| ||||| |||||| ||||||| |||||    
49291321 aatgactaacttgttacaattaaataacttaaaagacataactaatatga-aaaaacttaaaag 49291383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 80 - 155
Target Start/End: Original strand, 53769786 - 53769861
Alignment:
80 aattaaataacttaatagacctaactgatatgagaaaaactaaaaagaataatttattacaattaaacaacttaaa 155  Q
    |||||||||| |||| |||||||| || ||||| ||| ||| ||| || |||||||||||||||||| || |||||    
53769786 aattaaataatttaaaagacctaagtggtatgaaaaatacttaaatgattaatttattacaattaaataatttaaa 53769861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 76 - 158
Target Start/End: Original strand, 49291274 - 49291356
Alignment:
76 ttacaattaaataacttaatagacctaactgatatgagaaaaactaaaaagaataatttattacaattaaacaacttaaaaga 158  Q
    ||||||||||||||||||| |||| ||| || ||| | ||| ||| ||| || ||| || ||||||||||| |||||||||||    
49291274 ttacaattaaataacttaaaagacttaaatgttataaaaaatacttaaatgactaacttgttacaattaaataacttaaaaga 49291356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 66 - 94
Target Start/End: Original strand, 2803423 - 2803451
Alignment:
66 gaccaacttattacaattaaataacttaa 94  Q
    |||||||||||||||||||||||||||||    
2803423 gaccaacttattacaattaaataacttaa 2803451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 66 - 156
Target Start/End: Original strand, 6589561 - 6589651
Alignment:
66 gaccaacttattacaattaaataacttaatagacctaactgatatgagaaaaactaaaaagaataatttattacaattaaacaacttaaaa 156  Q
    |||||||||||||||||| | ||||||||  ||||||| || ||  | ||||||| ||| ||  |||||||||||||||||  ||||||||    
6589561 gaccaacttattacaattgattaacttaaatgacctaagtggtaccaaaaaaacttaaaggatcaatttattacaattaaattacttaaaa 6589651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 78 - 180
Target Start/End: Complemental strand, 12422125 - 12422023
Alignment:
78 acaattaaataacttaatagacctaactgatatgagaaaaactaaaaagaataatttattacaattaaacaacttaaaagatctttgatgtaatttaacc 177  Q
    |||||||| | ||||||  ||||||| || ||||| ||||||| ||| ||  |||||||||||||| || ||||||||||| ||  |||||| |||| ||    
12422125 acaattaatttacttaaaggacctaagtggtatgaaaaaaacttaaatgaccaatttattacaatttaataacttaaaagacctcggatgtagtttagcc 12422026  T
178 tat 180  Q
    |||    
12422025 tat 12422023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 66 - 156
Target Start/End: Original strand, 30551950 - 30552040
Alignment:
66 gaccaacttattacaattaaataacttaatagacctaactgatatgagaaaaactaaaaagaataatttattacaattaaacaacttaaaa 156  Q
    ||||||||| |||||||| | ||||||||  ||||||| || ||  | ||||||| ||| ||  ||||||||||||||||| |||||||||    
30551950 gaccaacttgttacaattgattaacttaaatgacctaagtggtaccaaaaaaacttaaaggaccaatttattacaattaaataacttaaaa 30552040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 69 - 174
Target Start/End: Original strand, 15907953 - 15908058
Alignment:
69 caacttattacaattaaataacttaatagacctaactgatatgagaaaaactaaaaagaataatttattacaattaaacaacttaaaagatctttgatgt 168  Q
    |||||| ||| |||||| |||| ||| | |||||| || ||||| ||||||| |||  | |||||||||||| ||||| | |||||| ||| |||| |||    
15907953 caacttgttataattaattaacctaaaaaacctaagtggtatgaaaaaaacttaaataactaatttattacagttaaatatcttaaaggatttttggtgt 15908052  T
169 aattta 174  Q
    ||||||    
15908053 aattta 15908058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 130 - 174
Target Start/End: Original strand, 12807704 - 12807748
Alignment:
130 aatttattacaattaaacaacttaaaagatctttgatgtaattta 174  Q
    ||||||| ||||||||| |||||||||||||| || |||||||||    
12807704 aatttataacaattaaataacttaaaagatctctggtgtaattta 12807748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 67 - 156
Target Start/End: Original strand, 6739652 - 6739740
Alignment:
67 accaacttattacaattaaataacttaatagacctaactgatatgagaaaaactaaaaagaataatttattacaattaaacaacttaaaa 156  Q
    ||||||||||||||||||| |||| | | |||||||| |||||| | ||||||| |||| |  ||||||||  ||||||| |||||||||    
6739652 accaacttattacaattaattaacatgaaagacctaagtgatataaaaaaaacttaaaa-accaatttattttaattaaataacttaaaa 6739740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 70 - 178
Target Start/End: Complemental strand, 10544131 - 10544024
Alignment:
70 aacttattacaattaaataacttaatagacctaactgatatgagaaaaactaaaaagaataatttattacaattaaacaacttaaaagatctttgatgta 169  Q
    ||||| ||||||||||||||||||| |||||||| |||||  | |||| || ||||||  || || ||| ||| ||| ||||| ||||||| | | ||||    
10544131 aacttgttacaattaaataacttaaaagacctaaatgata-caaaaaaccttaaaagaccaacttgttataatcaaataacttcaaagatcctcggtgta 10544033  T
170 atttaacct 178  Q
    |||||||||    
10544032 atttaacct 10544024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175923 times since January 2019
Visitors: 1577