View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-56 (Length: 354)

Name: J5-6-56
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-56
J5-6-56
[»] chr2 (2 HSPs)
chr2 (155-354)||(33355003-33355202)
chr2 (1-94)||(33355263-33355356)
[»] chr1 (1 HSPs)
chr1 (1-86)||(41530241-41530326)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 155 - 354
Target Start/End: Complemental strand, 33355202 - 33355003
Alignment:
155 ctccatgctagaaccaaaagaagaagaaaaacatgtatgtaatcttgaacttgtctaatatatgtatatttttagaatgttttacggttgaacttatcaa 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33355202 ctccatgctagaaccaaaagaagaagaaaaacatgtatgtaatcttgaacttgtctaatatatgtatatttttagaatgttttacggttgaacttatcaa 33355103  T
255 ttttagtgaaatgataaattttatatcngtnnnnnnnngattaacaatttgacagtgacatgctaaattctaagcttgagttattcttacgctagcattg 354  Q
    ||||||||||||||||||||||||||| ||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33355102 ttttagtgaaatgataaattttatatcagtaaaaaaaagattaacaatttgacagtgacatgctaaattctaagcttgagttattcttacgctagcattg 33355003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 33355356 - 33355263
Alignment:
1 atattcaatatttgtttagcctgatttgctttctttagacttcattgtatatatattgtttatctctttagcataaagaatcatatgttgggac 94  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33355356 atattcaatatttgtttagcctgatttgctttctttagacttcattgtatatatattgtttatctctttagcataaagaatcatatgttgggac 33355263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 41530326 - 41530241
Alignment:
1 atattcaatatttgtttagcctgatttgctttctttagacttcattgtatatatattgtttatctctttagcataaagaatcatat 86  Q
    |||||||||  | ||||||||| |||||||||||||||| || | ||||||||||||||| ||||||||  ||| || ||||||||    
41530326 atattcaatcatcgtttagcctaatttgctttctttagaatttaatgtatatatattgttgatctctttgacatcaaaaatcatat 41530241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361349 times since January 2019
Visitors: 487