View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-57 (Length: 463)

Name: J5-6-57
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-57
J5-6-57
[»] chr2 (1 HSPs)
chr2 (21-463)||(33354461-33354903)


Alignment Details
Target: chr2 (Bit Score: 395; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 395; E-Value: 0
Query Start/End: Original strand, 21 - 463
Target Start/End: Original strand, 33354461 - 33354903
Alignment:
21 caattgccaaacacaacaaacaaaacctagaacaagactcaacatgcaattcttgtcgcagaaaacacaatatttataataaatttctcaagcaacaatt 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33354461 caattgccaaacacaacaaacaaaacctagaacaagactcaacatgcaattcttgtcgcagaaaacacaatatttataataaatttctcaagcaacaatt 33354560  T
121 taaatcagactaaaaagacttttggattttataacatatataagcaacagtttaaatcggactaaaaagacttttggattctataacatatatgagttga 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33354561 taaatcagactaaaaagacttttggattttataacatatataagcaacagtttaaatcggactaaaaagacttttggattctataacatatatgagttga 33354660  T
221 aactctcagagttttgacatttatattcatcgattaaatcaacttaannnnnnnnncatttccctaacgaattaaaattttggcatttaaaatttaagat 320  Q
    |||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||||||||    
33354661 aactctcagagttttgacatttatattcatcgattaaatcaacttaatttttttttcatttccctaacgaattaaaattttggcatttaaaatttaagat 33354760  T
321 tgaatgagtgtatatagagngcttctagatgcatttaatctgatcactttagtatnataatgattgngtgtgaaacnatcttattttttgttttcaanaa 420  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||| ||    
33354761 tgaatgagtgtatatagagtgcttctagatgcatttaatctgatcactttagtataataatgattgtgtgtgaaactatcttattttttgttttcaaaaa 33354860  T
421 atatagagtcgngtgaaatttagatgtaattattaaaacntat 463  Q
    ||||||||||| ||||||||||||||||||||||||||| |||    
33354861 atatagagtcgtgtgaaatttagatgtaattattaaaacatat 33354903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108426 times since January 2019
Visitors: 1329