View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-58 (Length: 403)

Name: J5-6-58
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-58
J5-6-58
[»] chr8 (4 HSPs)
chr8 (136-403)||(32535806-32536073)
chr8 (1-142)||(32536069-32536210)
chr8 (1-87)||(39548795-39548881)
chr8 (347-385)||(39548729-39548767)
[»] chr6 (5 HSPs)
chr6 (1-86)||(27336354-27336439)
chr6 (1-86)||(27397094-27397179)
chr6 (350-395)||(27336454-27336499)
chr6 (350-395)||(27397194-27397239)
chr6 (88-125)||(4513116-4513153)
[»] chr3 (7 HSPs)
chr3 (1-86)||(3113218-3113303)
chr3 (1-74)||(28879576-28879650)
chr3 (347-395)||(3113318-3113366)
chr3 (347-403)||(28879646-28879702)
chr3 (88-131)||(36684943-36684986)
chr3 (240-285)||(26390514-26390559)
chr3 (88-125)||(51976804-51976841)
[»] chr1 (8 HSPs)
chr1 (1-86)||(6841411-6841496)
chr1 (350-395)||(6841511-6841556)
chr1 (88-131)||(44839887-44839930)
chr1 (88-125)||(11351627-11351664)
chr1 (88-125)||(21515247-21515284)
chr1 (88-126)||(51080702-51080740)
chr1 (88-125)||(2536512-2536549)
chr1 (242-306)||(25396209-25396273)
[»] chr5 (2 HSPs)
chr5 (88-125)||(41197386-41197423)
chr5 (236-302)||(39714923-39714989)
[»] chr2 (4 HSPs)
chr2 (88-125)||(24543257-24543294)
chr2 (88-125)||(29894351-29894388)
chr2 (354-403)||(3272788-3272837)
chr2 (88-125)||(36365084-36365121)
[»] chr4 (2 HSPs)
chr4 (254-295)||(48563990-48564031)
chr4 (88-132)||(43813201-43813245)


Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 136 - 403
Target Start/End: Original strand, 32535806 - 32536073
Alignment:
136 caattgatatgagaggagggagtaccattatggcattggtcctaagaaattggtataccagcggagctattgtagtcactacgaccaaatctannnnnnn 235  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||           
32535806 caattgatatgagaggagggagtaccattatggcattggtcctaagaaattggtataccagcggagctattgtagtcactacgaccaaatctattttttt 32535905  T
236 -aggaaagaaaatcattgtttttcattagctatcaattatctaatacatgattgtacatcattataaatgtgtgtgagttagagtgagatggggcaggat 334  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32535906 taggaaagaaaatcattgtttttcattagctatcaattatctaatacatgattgtacatcattataaatgtgtgtgagttagagtgagatggggcaggat 32536005  T
335 tggatcttccccccagtggaatccnagccattaaatgataaatacatgtgaggaattaaatgtcaaaat 403  Q
    |||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
32536006 tggatctt-ctcccagtggaatcctagccattaaatgataaatacatgtgaggaattaaatgtcaaaat 32536073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 32536069 - 32536210
Alignment:
1 aaaatgaagagagataatgtatttaatggtttagatttaaacagtagaaaactggagaaagttttcacaggagggaatatgctcccggatggggctaccc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32536069 aaaatgaagagagataatgtatttaatggtttagatttaaacagtagaaaactggagaaagttttcacaggagggaatatgctcccggatggggctaccc 32536168  T
101 tagctaattcacgagcgaccccattaacttgttttcaattga 142  Q
    ||||||||||||||||||||||||||||||||||||||||||    
32536169 tagctaattcacgagcgaccccattaacttgttttcaattga 32536210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 39548795 - 39548881
Alignment:
1 aaaatgaagagagataatgtatttaatggtttagatttaaacagtagaaaactggagaaagttttcacaggagggaatatgctcccg 87  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |||||||||| ||| || ||| ||||||||    
39548795 aaaatgaagagaaataatatatttaatggtttagatttaaacagtagaaaactggaaaaagttttcagaggtggaaatctgctcccg 39548881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 347 - 385
Target Start/End: Original strand, 39548729 - 39548767
Alignment:
347 ccagtggaatccnagccattaaatgataaatacatgtga 385  Q
    |||||||||||| ||||||||||| ||||||||||||||    
39548729 ccagtggaatcctagccattaaataataaatacatgtga 39548767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 82; Significance: 1e-38; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 27336439 - 27336354
Alignment:
1 aaaatgaagagagataatgtatttaatggtttagatttaaacagtagaaaactggagaaagttttcacaggagggaatatgctccc 86  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
27336439 aaaatgaagagagataatgtatttaatggtttagatttaaacagtagaaaactggagaaagttttcacaggagggaatctgctccc 27336354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 27397179 - 27397094
Alignment:
1 aaaatgaagagagataatgtatttaatggtttagatttaaacagtagaaaactggagaaagttttcacaggagggaatatgctccc 86  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
27397179 aaaatgaagagagataatgtatttaatggtttagatttaaacagtagaaaactggagaaagttttcacaggagggaatctgctccc 27397094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 350 - 395
Target Start/End: Complemental strand, 27336499 - 27336454
Alignment:
350 gtggaatccnagccattaaatgataaatacatgtgaggaattaaat 395  Q
    ||||||||| |||||||||||||||||||||||||| |||||||||    
27336499 gtggaatcctagccattaaatgataaatacatgtgaagaattaaat 27336454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 350 - 395
Target Start/End: Complemental strand, 27397239 - 27397194
Alignment:
350 gtggaatccnagccattaaatgataaatacatgtgaggaattaaat 395  Q
    ||||||||| |||||||||||||||||||||||||| |||||||||    
27397239 gtggaatcctagccattaaatgataaatacatgtgaagaattaaat 27397194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 88 - 125
Target Start/End: Complemental strand, 4513153 - 4513116
Alignment:
88 gatggggctaccctagctaattcacgagcgaccccatt 125  Q
    ||||||||||||||||||||||||  ||||||||||||    
4513153 gatggggctaccctagctaattcattagcgaccccatt 4513116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 82; Significance: 1e-38; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 3113303 - 3113218
Alignment:
1 aaaatgaagagagataatgtatttaatggtttagatttaaacagtagaaaactggagaaagttttcacaggagggaatatgctccc 86  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
3113303 aaaatgaagagagataatgtatttaatggtttagatttaaacagtagaaaactggagaaagttttcacaggagggaatctgctccc 3113218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 28879650 - 28879576
Alignment:
1 aaaatgaagagagataatgtatttaatggtttagat-ttaaacagtagaaaactggagaaagttttcacaggagg 74  Q
    |||||||| |||||||||||| |||||||||||||| |||||| ||||||||||| ||||||| |||||| ||||    
28879650 aaaatgaatagagataatgtacttaatggtttagatgttaaaccgtagaaaactgcagaaagtattcacaagagg 28879576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 347 - 395
Target Start/End: Complemental strand, 3113366 - 3113318
Alignment:
347 ccagtggaatccnagccattaaatgataaatacatgtgaggaattaaat 395  Q
    |||||||||||| | ||||||||||||||||| ||||||||||||||||    
3113366 ccagtggaatcctaaccattaaatgataaatagatgtgaggaattaaat 3113318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 28879702 - 28879646
Alignment:
347 ccagtggaatccnagccattaaatgataaatacatgtgaggaattaaatgtcaaaat 403  Q
    |||||| ||||| ||||||||||| |||| ||||||||||||||||||| |||||||    
28879702 ccagtgtaatcctagccattaaataataattacatgtgaggaattaaatatcaaaat 28879646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 88 - 131
Target Start/End: Complemental strand, 36684986 - 36684943
Alignment:
88 gatggggctaccctagctaattcacgagcgaccccattaacttg 131  Q
    |||||||||||||||||||||||| |||||||||||||| ||||    
36684986 gatggggctaccctagctaattcatgagcgaccccattagcttg 36684943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 285
Target Start/End: Original strand, 26390514 - 26390559
Alignment:
240 aagaaaatcattgtttttcattagctatcaattatctaatacatga 285  Q
    |||||| |||||| ||||||||||||||||| | ||||||||||||    
26390514 aagaaattcattgattttcattagctatcaactgtctaatacatga 26390559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 88 - 125
Target Start/End: Complemental strand, 51976841 - 51976804
Alignment:
88 gatggggctaccctagctaattcacgagcgaccccatt 125  Q
    ||||| |||||||||||||||||| |||||||||||||    
51976841 gatggagctaccctagctaattcatgagcgaccccatt 51976804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 78; Significance: 3e-36; HSPs: 8)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 6841496 - 6841411
Alignment:
1 aaaatgaagagagataatgtatttaatggtttagatttaaacagtagaaaactggagaaagttttcacaggagggaatatgctccc 86  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||    
6841496 aaaatgaagagagataatgtatttaatggtttagatttaaacggtagaaaactggagaaagttttcacaggagggaatctgctccc 6841411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 350 - 395
Target Start/End: Complemental strand, 6841556 - 6841511
Alignment:
350 gtggaatccnagccattaaatgataaatacatgtgaggaattaaat 395  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||    
6841556 gtggaatcctagccattaaatgataaatacatgtgaggaattaaat 6841511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 88 - 131
Target Start/End: Original strand, 44839887 - 44839930
Alignment:
88 gatggggctaccctagctaattcacgagcgaccccattaacttg 131  Q
    |||||||||||||||||||| ||| |||||||||||||||||||    
44839887 gatggggctaccctagctaactcatgagcgaccccattaacttg 44839930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 88 - 125
Target Start/End: Original strand, 11351627 - 11351664
Alignment:
88 gatggggctaccctagctaattcacgagcgaccccatt 125  Q
    |||||||||||||||||||||||| |||||||||||||    
11351627 gatggggctaccctagctaattcatgagcgaccccatt 11351664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 88 - 125
Target Start/End: Complemental strand, 21515284 - 21515247
Alignment:
88 gatggggctaccctagctaattcacgagcgaccccatt 125  Q
    |||||||||||||||||||||||| |||||||||||||    
21515284 gatggggctaccctagctaattcatgagcgaccccatt 21515247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 88 - 126
Target Start/End: Original strand, 51080702 - 51080740
Alignment:
88 gatggggctaccctagctaattcacgagcgaccccatta 126  Q
    |||||||||||||| ||||||||| ||||||||||||||    
51080702 gatggggctaccctcgctaattcatgagcgaccccatta 51080740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 88 - 125
Target Start/End: Original strand, 2536512 - 2536549
Alignment:
88 gatggggctaccctagctaattcacgagcgaccccatt 125  Q
    ||||||||||||||| |||||||| |||||||||||||    
2536512 gatggggctaccctaactaattcatgagcgaccccatt 2536549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 242 - 306
Target Start/End: Original strand, 25396209 - 25396273
Alignment:
242 gaaaatcattgtttttcattagctatcaat-tatctaatacatgattgtacatcattataaatgtg 306  Q
    |||| |||||||||||||||||||| |||| | ||||||||||||| |||||||| | ||||||||    
25396209 gaaattcattgtttttcattagcta-caatgtgtctaatacatgatggtacatcagtgtaaatgtg 25396273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 88 - 125
Target Start/End: Original strand, 41197386 - 41197423
Alignment:
88 gatggggctaccctagctaattcacgagcgaccccatt 125  Q
    |||||||||||||||||||||||| |||||||||||||    
41197386 gatggggctaccctagctaattcatgagcgaccccatt 41197423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 236 - 302
Target Start/End: Complemental strand, 39714989 - 39714923
Alignment:
236 aggaaagaaaatcattgtttttcattagctatcaattatctaatacatgattgtacatcattataaa 302  Q
    |||||||||| |||| |||||||||||  |||||||||| ||||| ||||  ||||||||| |||||    
39714989 aggaaagaaattcatagtttttcattaaatatcaattatttaatatatgaccgtacatcatcataaa 39714923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000006; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 88 - 125
Target Start/End: Complemental strand, 24543294 - 24543257
Alignment:
88 gatggggctaccctagctaattcacgagcgaccccatt 125  Q
    |||||||||||||||||||||||| |||||||||||||    
24543294 gatggggctaccctagctaattcatgagcgaccccatt 24543257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 88 - 125
Target Start/End: Original strand, 29894351 - 29894388
Alignment:
88 gatggggctaccctagctaattcacgagcgaccccatt 125  Q
    |||||||||||||||||||||||| |||||||||||||    
29894351 gatggggctaccctagctaattcatgagcgaccccatt 29894388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 354 - 403
Target Start/End: Complemental strand, 3272837 - 3272788
Alignment:
354 aatccnagccattaaatgataaatacatgtgaggaattaaatgtcaaaat 403  Q
    ||||| ||||||| ||| ||||||| |||||||||||||||||| |||||    
3272837 aatccaagccattgaataataaataaatgtgaggaattaaatgttaaaat 3272788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 88 - 125
Target Start/End: Complemental strand, 36365121 - 36365084
Alignment:
88 gatggggctaccctagctaattcacgagcgaccccatt 125  Q
    |||||||||||||||||||||||| |||||||| ||||    
36365121 gatggggctaccctagctaattcatgagcgacctcatt 36365084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 295
Target Start/End: Original strand, 48563990 - 48564031
Alignment:
254 ttttcattagctatcaattatctaatacatgattgtacatca 295  Q
    |||||||||| |||||||||| ||||||||||| ||||||||    
48563990 ttttcattagatatcaattatgtaatacatgatggtacatca 48564031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 88 - 132
Target Start/End: Original strand, 43813201 - 43813245
Alignment:
88 gatggggctaccctagctaattcacgagcgaccccattaacttgt 132  Q
    ||||||||||||||| |||||||| || |||||||||| ||||||    
43813201 gatggggctaccctaactaattcatgaacgaccccattgacttgt 43813245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105783 times since January 2019
Visitors: 1319