View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-63 (Length: 425)

Name: J5-6-63
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-63
J5-6-63
[»] chr5 (2 HSPs)
chr5 (133-425)||(14413922-14414214)
chr5 (1-138)||(14413789-14413926)


Alignment Details
Target: chr5 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 133 - 425
Target Start/End: Complemental strand, 14414214 - 14413922
Alignment:
133 caattgttaatgagcttcaacaaatatgtgcgaaccctgggacacctctttttagaaaccctgtagtgaatttcgatgagacaccagcgttgcttgacaa 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14414214 caattgttaatgagcttcaacaaatatgtgcgaaccctgggacacctctttttagaaaccctgtagtgaatttcgatgagacaccagcgttgcttgacaa 14414115  T
233 cttgttttttaagaatatggtgacgaagaagaagacgcttttggttacagatgctcatttgtttaatgatcctaggacaattcctattgttgaagaactt 332  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14414114 cttgttttttaagaatatggtgacgaagaagaagacgcttttggttacagatgctcatttgtttaatgatcctaggacaattcctattgttgaagaactt 14414015  T
333 gctaaggataatggtttgtttcaaaagaagtttgctgaagctatggttaagatgggntcttaccatgttattacngggaatgatggtgaggtg 425  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||||    
14414014 gctaaggataatggtttgtttcaaaagaagtttgctgaagctatggttaagatgggttcttacaatgttattactgggaatgatggtgaggtg 14413922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 14413926 - 14413789
Alignment:
1 aggtgaggaagacttgcaggtcaactaattaattaattaattattcttcattaatatatatgtgaaaattgtaatggtgtttaacacattttgtttatan 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
14413926 aggtgaggaagacttgcaggtcaactaattaattaattaattattcttcattaatatatatgtgaaaattgtaatggtgtttaacacattttgtttatat 14413827  T
101 nnnnnngttatcacagtgtaataataaatgatcaattg 138  Q
          ||||||||||||||||||||||||||||||||    
14413826 ttttttgttatcacagtgtaataataaatgatcaattg 14413789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111109 times since January 2019
Visitors: 1335