View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-66 (Length: 546)

Name: J5-6-66
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-66
J5-6-66
[»] chr3 (1 HSPs)
chr3 (1-546)||(48317219-48317763)


Alignment Details
Target: chr3 (Bit Score: 477; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 477; E-Value: 0
Query Start/End: Original strand, 1 - 546
Target Start/End: Original strand, 48317219 - 48317763
Alignment:
1 caatatgcctatgatctgttgtggcttggatagtatacttccttctaagaacggagactttctgttgcacgatacatgtctgcagtttcagcaaaccatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48317219 caatatgcctatgatctgttgtggcttggatagtatacttccttctaagaacggagactttctgttgcacgatacatgtctgcagtttcagcaaaccatc 48317318  T
101 gcctcttctaacctgtatccatatagactccacacgtcggttgatcttgccaagctgagaactaaactcagaattggtcttgaccgatacaaaggattta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48317319 gcctcttctaacctgtatccatatagactccacacgtcggttgatcttgccaagctgagaactaaactcagaattggtcttgaccgatacaaaggattta 48317418  T
201 tcagcgtcgtcgacatcatgttcagagaatccttcaaggatgtctcctggtaatggcatgctctcatcccattcatcagctacctcttgcttcacttgtt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48317419 tcagcgtcgtcgacatcatgttcagagaatccttcaaggatgtctcctggtaatggcatgctctcatcccattcatcagctacctcttgcttcacttgtt 48317518  T
301 tcacacaaacaagtgtttgatctgaggcagccatttcctcctaggatatgaaactgaaaattgggtcccagctagttatcctagtaaaaatactagtgtg 400  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||    
48317519 tcacacaaacaagtgtttgatctgaggcagccatttcctcctaggatatgaaactgaaaattgggtccaagctagttatcctagt-aaaatactagtgtg 48317617  T
401 acatccttgaagttaaatgggtctatatgcttttaacatatgttctttcttggggcccataaaatatccgcccttcattgttctgataagac-aacaccc 499  Q
    |||| |||||||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||| || ||||||||||||||||||||| ||||||     
48317618 acat-cttgaagttaaatgtgtctatatgcttttaacatatgttctttcttgtggcctataaaatat-cgtccttcattgttctgataagacaaacacca 48317715  T
500 agaggcc-aagctatggccggcacccaatttctcattaccggntgcaa 546  Q
    ||||||| ||||||||||||||||| |||||||||||||||| |||||    
48317716 agaggccaaagctatggccggcaccaaatttctcattaccggctgcaa 48317763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108246 times since January 2019
Visitors: 1329