View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-69 (Length: 510)

Name: J5-6-69
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-69
J5-6-69
[»] scaffold0015 (7 HSPs)
scaffold0015 (56-445)||(37618-38005)
scaffold0015 (56-445)||(18418-18805)
scaffold0015 (56-284)||(12111-12339)
scaffold0015 (329-429)||(11946-12045)
scaffold0015 (1-39)||(19222-19260)
scaffold0015 (1-39)||(37163-37201)
scaffold0015 (1-39)||(11476-11514)


Alignment Details
Target: scaffold0015 (Bit Score: 308; Significance: 1e-173; HSPs: 7)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 56 - 445
Target Start/End: Complemental strand, 38005 - 37618
Alignment:
56 atctnccaccaagttgagtgaatggagtgagagttccactgatnagagaaccnttctcattttgtttgaaagangaaggcatagcnggccatacaaaagc 155  Q
    |||| |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||    
38005 atctaccaccaagttgagtgaatggagtgagagttccactgataagagaaccattctcattttgtttgaaagatgaaggcatagcaggccatacaaaagc 37906  T
156 cggtctttcnatcggaaccattggaggagaagcttctccnttaagaaccatcaatacagttntcnttgatggtctttcatggggatttggatgacaacaa 255  Q
    ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||| ||||||||||||||||||    
37905 cggtctttcaatcggaaccattggaggagaagcttctccattaagaaccatcaatacagttttcattgatggtctttcatgtggatttggatgacaacaa 37806  T
256 gacgacccnagaataagcacagtttcaacctttncaatttctncctcttcnctacttatcctatcatcaactgcactaactntttttccctctccataaa 355  Q
    ||| |||| |||||||||||| ||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||    
37805 gacaacccaagaataagcacaatttcaaccttttcaatttcttcctcttcactacttatcctatcatcaactgcactaactatttttccctctccataaa 37706  T
356 gtncccaaacccaatacacaatactgtatttataatcntcttgtgcatacatntttccttggtctttttccacaccacaacttcnaaaac 445  Q
    || |||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||| ||||||||| |||||    
37705 gttcccaaacccaatacacaatactgtatttataatcatcttgtgcatacatattt-cttggtctttttccaca-cacaacttccaaaac 37618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015; HSP #2
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 56 - 445
Target Start/End: Original strand, 18418 - 18805
Alignment:
56 atctnccaccaagttgagtgaatggagtgagagttccactgatnagagaaccnttctcattttgtttgaaagangaaggcatagcnggccatacaaaagc 155  Q
    |||| |||| ||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||| |||||||||||   ||| ||||||||    
18418 atctgccactaagttgagtgaatggagtgagagttccactgataagagaaccattttcattttgtttgaaagatgaaggcatagcattccaaacaaaagc 18517  T
156 cggtctttcnatcggaaccattggaggagaagcttctccnttaagaaccatcaatacagttntcnttgatggtctttcatggggatttggatgacaacaa 255  Q
    ||||||||| ||||||||||||||||||||||||||||| || ||||||||||| |||||| || ||| |||||||||||| ||||||||||||||||||    
18518 cggtctttcaatcggaaccattggaggagaagcttctccatttagaaccatcaaaacagttttcattgttggtctttcatgtggatttggatgacaacaa 18617  T
256 gacgacccnagaataagcacagtttcaacctttncaatttctncctcttcnctacttatcctatcatcaactgcactaactntttttccctctccataaa 355  Q
    ||| |||| |||||||||||| ||||||||||| || ||||  ||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||    
18618 gacaacccaagaataagcacaatttcaaccttttcagtttcagcctcttcactacttatcctatcatcaactgcactaactttttttccctcttcataaa 18717  T
356 gtncccaaacccaatacacaatactgtatttataatcntcttgtgcatacatntttccttggtctttttccacaccacaacttcnaaaac 445  Q
    |  |||||||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| ||||||||| |||||    
18718 gctcccaaacccaatacacaatactatatttataatcatcttgtgcatacatattt-cttggtctttttccaca-cacaacttccaaaac 18805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015; HSP #3
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 56 - 284
Target Start/End: Complemental strand, 12339 - 12111
Alignment:
56 atctnccaccaagttgagtgaatggagtgagagttccactgatnagagaaccnttctcattttgtttgaaagangaaggcatagcnggccatacaaaagc 155  Q
    |||| |||| ||||| |||||| ||||||||||||||| |||| |||||||  |  |||  || ||||||||| |||||||| || ||||| ||||||||    
12339 atcttccactaagttcagtgaacggagtgagagttccattgataagagaactatcttcaccttctttgaaagatgaaggcatggctggccaaacaaaagc 12240  T
156 cggtctttcnatcggaaccattggaggagaagcttctccnttaagaaccatcaatacagttntcnttgatggtctttcatggggatttggatgacaacaa 255  Q
    ||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||| || ||||||| |||| ||  ||||||||||||||||||    
12239 cggtctttcaatcggaaccattggaggagaagcttctccattaagaaccatcaaaacagttttcattgatggccttttatttggatttggatgacaacaa 12140  T
256 gacgacccnagaataagcacagtttcaac 284  Q
    | | |||| | |||||||||| |||||||    
12139 gccaaccctaaaataagcacaatttcaac 12111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015; HSP #4
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 329 - 429
Target Start/End: Complemental strand, 12045 - 11946
Alignment:
329 cactaactntttttccctctccataaagtncccaaacccaatacacaatactgtatttataatcntcttgtgcatacatntttccttggtctttttccac 428  Q
    |||||||  ||||||| | |||||||||  |||||||||||||||||||||| | |||||| || |||||||||||||  ||||| ||||||||||||||    
12045 cactaacaatttttccatttccataaagctcccaaacccaatacacaatactatttttatagtcatcttgtgcatacacatttcc-tggtctttttccac 11947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 19222 - 19260
Alignment:
1 tgagtttcaccaagtttttgtggtgaaggcttccanttg 39  Q
    ||||||||||||||||||||||||||||||||||| |||    
19222 tgagtttcaccaagtttttgtggtgaaggcttccaattg 19260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015; HSP #6
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 37201 - 37163
Alignment:
1 tgagtttcaccaagtttttgtggtgaaggcttccanttg 39  Q
    ||||||||||||||||||||||||||||||||||| |||    
37201 tgagtttcaccaagtttttgtggtgaaggcttccaattg 37163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 11514 - 11476
Alignment:
1 tgagtttcaccaagtttttgtggtgaaggcttccanttg 39  Q
    ||||||||||||||||||||||||||||||| ||| |||    
11514 tgagtttcaccaagtttttgtggtgaaggctaccaattg 11476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108056 times since January 2019
Visitors: 1329