View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-80 (Length: 787)

Name: J5-6-80
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-80
J5-6-80
[»] chr4 (2 HSPs)
chr4 (1-675)||(48439968-48440640)
chr4 (666-787)||(48440636-48440757)


Alignment Details
Target: chr4 (Bit Score: 655; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 655; E-Value: 0
Query Start/End: Original strand, 1 - 675
Target Start/End: Complemental strand, 48440640 - 48439968
Alignment:
1 tatatatcatgaatttgtttttataaaattctataccatgatattgtaacaaacatgcagcaaatattccctaggaagaccatgcaacaaacattcccta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48440640 tatatatcatgaatttgtttttataaaattctataccatgatattgtaacaaacatgcagcaaatattccctaggaagaccatgcaacaaacattcccta 48440541  T
101 ggaaaacgaatacttagtggttgataaaaataacataaaaattgtacaacgcattccatctactataaaacaagagaaacaagggcctagaagtattgtc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48440540 ggaaaacgaatacttagtggttgataaaaataacataaaaattgtacaacgcattccatctactataaaacaagagaaacaagggcctagaagtattgtc 48440441  T
201 atctccctaatgcaaaaagtcatcacttgataattttttctttcattgctctttcaacccttagtaggagcctctgctgttagagagctagagaagtgga 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48440440 atctccctaatgcaaaaagtcatcacttgataattttttctttcattgctctttcaacccttagtaggagcctctgctgttagagagctagagaagtgga 48440341  T
301 gctcctcctagggctggttgaaagaaaaatttgaaagaggaagagaccaattttatcgttttggtcataatgtcgtctgacaatctatttgaagaactca 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||    
48440340 gctcctcctagggctggttgaaagaaaaatttgaaagaggaagagacaaattttatcgtttt-gtcataatgtcgtctgacaatctatttgaagaactca 48440242  T
401 aggaatgagaatgttgatctcgtaagacaaaaatgacacgcgtaatgccatgcatggttttaaattgtggtttgcaacaacattgaactttatacatttc 500  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48440241 a-gaatgagaatgttgatctcgtaagacaaaaatgacacgcgtaatgccatgcatggttttaaattgtggtttgcaacaacattgaactttatacatttc 48440143  T
501 aactgtattagctgtacttttcctcaatataaatgtttgatgctgcgaccacaatttaaaaccacgatgtcatgcattggcatgattattaatttttaat 600  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48440142 aactgtattagctgtacttttcctcaatataaatgtttgatgctgcgaccacaatttaaaaccacgatgtcatgcattggcatgattattaatttttaat 48440043  T
601 tacttattttcctttgtaatgacaattaagttgttacgttgcatgtgtatatgtgcaggaaaacattccaattga 675  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48440042 tacttattttcctttgtaatgacaattaagttgttacgttgcatgtgtatatgtgcaggaaaacattccaattga 48439968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 122; E-Value: 4e-62
Query Start/End: Original strand, 666 - 787
Target Start/End: Complemental strand, 48440757 - 48440636
Alignment:
666 ttccaattgaaccctcccaacaaattttgtatcccatcattaaattgttctcccaaatttagcatgtaattgaccaccaacaaaaatatctttctttttt 765  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48440757 ttccaattgaaccctcccaacaaattttgtatcccatcattaaattgttctcccaaatttagcatgtaattgaccaccaacaaaaatatctttctttttt 48440658  T
766 acacaacaaaaatagcttatat 787  Q
    ||||||||||||||||||||||    
48440657 acacaacaaaaatagcttatat 48440636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360154 times since January 2019
Visitors: 482