View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-6-93 (Length: 378)

Name: J5-6-93
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-6-93
J5-6-93
[»] chr1 (6 HSPs)
chr1 (1-313)||(33177934-33178246)
chr1 (3-309)||(33155148-33155448)
chr1 (29-193)||(33137385-33137549)
chr1 (24-192)||(33290360-33290528)
chr1 (308-365)||(33176784-33176840)
chr1 (38-119)||(33121757-33121838)
[»] chr4 (1 HSPs)
chr4 (53-177)||(6679763-6679887)
[»] chr3 (1 HSPs)
chr3 (53-149)||(55124989-55125082)


Alignment Details
Target: chr1 (Bit Score: 313; Significance: 1e-176; HSPs: 6)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 33177934 - 33178246
Alignment:
1 acctattcaaattggaaatggagatattattgaccataaccctttaaccatgtctgatgaacacattttggaagagatttattcaactcatgtccatagt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33177934 acctattcaaattggaaatggagatattattgaccataaccctttaaccatgtctgatgaacacattttggaagagatttattcaactcatgtccatagt 33178033  T
101 gacactaagtttgatgctgaatatcttttcaacattgctggcaacatccttacacgttcaacccatgttgttgataactttgtgcaagtatgtgtatatt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33178034 gacactaagtttgatgctgaatatcttttcaacattgctggcaacatccttacacgttcaacccatgttgttgataactttgtgcaagtatgtgtatatt 33178133  T
201 tgcatctatctctccattctttttattatatagtatactgcttctaactaaataatgttaacttgtttgtttatacgtagggacatgaatatcaagcaag 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33178134 tgcatctatctctccattctttttattatatagtatactgcttctaactaaataatgttaacttgtttgtttatacgtagggacatgaatatcaagcaag 33178233  T
301 tgtggagcaattg 313  Q
    |||||||||||||    
33178234 tgtggagcaattg 33178246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 3 - 309
Target Start/End: Original strand, 33155148 - 33155448
Alignment:
3 ctattcaaattggaaatggagatattattgaccataaccctttaaccatgtctgatgaacacattttggaagagatttattcaactcatgtccatagtga 102  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33155148 ctattcacattggaaatggagatattattgaccataaccctttaaccatgtctgatgaacacattttggaagagatttattcaactcatgtccatagtga 33155247  T
103 cactaagtttgatgctgaatatcttttcaacattgctggcaacatccttacacgttcaacccatgttgttgataactttgtgcaagtatgtgtatatttg 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
33155248 cactaagtttgatgctgaatatcttttcaacattgctggcaacatccttacacgttcaacccatgttgttgataactttgtgcaagtatgtatatatttg 33155347  T
203 catctatctctccattctttttattatatagtatactgcttctaactaaataatgttaacttgtttgttta-tacgtagggacatgaatatcaagcaagt 301  Q
    || |||| |    ||| || || |||| ||||||||||||| ||  | ||||||||||||||||||| ||| |||  ||||||||||| | ||| |||||    
33155348 cacctattt----att-ttctttttatgtagtatactgcttttagttgaataatgttaacttgtttgattattac--agggacatgaacaacaaacaagt 33155440  T
302 gtggagca 309  Q
     |||||||    
33155441 ctggagca 33155448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 29 - 193
Target Start/End: Original strand, 33137385 - 33137549
Alignment:
29 attgaccataaccctttaaccatgtctgatgaacacattttggaagagatttattcaactcatgtccatagtgacactaagtttgatgctgaatatcttt 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||| |||||    
33137385 attgaccataaccctttaaccatgtctgatgaacacattttggaagagatttatgtaactcatgtccatagtgacactaagtttgatgctgaatctcttt 33137484  T
129 tcaacattgctggcaacatccttacacgttcaacccatgttgttgataactttgtgcaagtatgt 193  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||| || |||||||||||    
33137485 tcaacattgctgggaacatccttacacgttcaacccatgttgttgataacgttctgcaagtatgt 33137549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 24 - 192
Target Start/End: Complemental strand, 33290528 - 33290360
Alignment:
24 atattattgaccataaccctttaaccatgtctgatgaacacattttggaagagatttattcaactcatgtccatagtgacactaagtttgatgctgaata 123  Q
    |||||||| || |||||||||| | ||||||||||  ||| ||| |||  |||||||||||||| ||||||||||||||||| |||||||||| |||||     
33290528 atattattcacaataaccctttgatcatgtctgatatacaaattatgggggagatttattcaacccatgtccatagtgacaccaagtttgatgttgaatc 33290429  T
124 tcttttcaacattgctggcaacatccttacacgttcaacccatgttgttgataactttgtgcaagtatg 192  Q
    |||||||||||||||||  ||||| ||||  ||||||||| || ||||||| ||| |||||||||||||    
33290428 tcttttcaacattgctgcaaacattcttaggcgttcaacctatattgttgaaaacgttgtgcaagtatg 33290360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 33176784 - 33176840
Alignment:
308 caattgttgtgaggcatctcaaccattttaataatcctttcaattancataagatatt 365  Q
    ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||    
33176784 caattgttgtgaggcatctcaaccattttaataat-ctttcaattaacataagatatt 33176840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 38 - 119
Target Start/End: Complemental strand, 33121838 - 33121757
Alignment:
38 aaccctttaaccatgtctgatgaacacattttggaagagatttattcaactcatgtccatagtgacactaagtttgatgctg 119  Q
    ||||| ||||||||||||||||| || ||||||||  | ||||| || ||||||||||| |||||||| || ||||||||||    
33121838 aacccattaaccatgtctgatgaccagattttggatcaaatttactccactcatgtccacagtgacacaaaatttgatgctg 33121757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 53 - 177
Target Start/End: Original strand, 6679763 - 6679887
Alignment:
53 tctgatgaacacattttggaagagatttattcaactcatgtccatagtgacactaagtttgatgctgaatatcttttcaacattgctggcaacatcctta 152  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||||| |||||||||     
6679763 tctgatgaacacattttggaagagatttattcaactcatgtctatagtgatactaagtttgatgctgaatatattttcaacattgctggaaacatccttg 6679862  T
153 cacgttcaacccatgttgttgataa 177  Q
      ||||||| |||||||||||||||    
6679863 tgcgttcaatccatgttgttgataa 6679887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 53 - 149
Target Start/End: Complemental strand, 55125082 - 55124989
Alignment:
53 tctgatgaacacattttggaagagatttattcaactcatgtccatagtgacactaagtttgatgctgaatatcttttcaacattgctggcaacatcc 149  Q
    |||||||||||||||||  |||||||||||||||||   ||||| |||||  |||||||||| |||||||||||||||||||||||||| |||||||    
55125082 tctgatgaacacattttacaagagatttattcaact---gtccacagtgatgctaagtttgacgctgaatatcttttcaacattgctggaaacatcc 55124989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 311154 times since January 2019
Visitors: 444