View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-60 (Length: 309)

Name: J5-60
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-60
J5-60
[»] chr8 (21 HSPs)
chr8 (1-309)||(32927627-32927936)
chr8 (237-307)||(44141093-44141163)
chr8 (265-309)||(15677857-15677901)
chr8 (206-309)||(16972105-16972208)
chr8 (240-302)||(37684380-37684442)
chr8 (205-283)||(42455852-42455930)
chr8 (265-309)||(35494990-35495034)
chr8 (242-309)||(4662944-4663011)
chr8 (243-309)||(10367973-10368039)
chr8 (221-302)||(26100194-26100276)
chr8 (210-297)||(7644510-7644596)
chr8 (206-309)||(13384695-13384798)
chr8 (240-299)||(38868473-38868532)
chr8 (231-305)||(11572503-11572577)
chr8 (248-300)||(1836262-1836315)
chr8 (218-255)||(7533750-7533787)
chr8 (206-283)||(35495201-35495278)
chr8 (240-284)||(4950459-4950503)
chr8 (245-300)||(11791783-11791839)
chr8 (206-298)||(26668493-26668585)
chr8 (265-309)||(32994283-32994327)
[»] chr4 (26 HSPs)
chr4 (206-309)||(35065004-35065107)
chr4 (220-309)||(32818411-32818500)
chr4 (237-307)||(50061671-50061741)
chr4 (210-302)||(54705438-54705531)
chr4 (207-297)||(25318989-25319080)
chr4 (240-305)||(26617443-26617508)
chr4 (217-302)||(46344880-46344964)
chr4 (221-302)||(49138811-49138891)
chr4 (219-309)||(9134564-9134654)
chr4 (219-300)||(33560620-33560702)
chr4 (247-300)||(11271587-11271641)
chr4 (221-298)||(43868092-43868169)
chr4 (265-309)||(8604663-8604707)
chr4 (221-309)||(9064187-9064275)
chr4 (265-305)||(30357512-30357552)
chr4 (265-309)||(55187003-55187047)
chr4 (243-298)||(29779106-29779161)
chr4 (210-309)||(39733679-39733777)
chr4 (221-302)||(8330071-8330153)
chr4 (206-292)||(49138894-49138979)
chr4 (205-302)||(22250166-22250263)
chr4 (242-307)||(41370053-41370118)
chr4 (206-298)||(16551898-16551990)
chr4 (265-305)||(30357647-30357687)
chr4 (204-284)||(48045767-48045847)
chr4 (242-302)||(53713609-53713669)
[»] chr6 (16 HSPs)
chr6 (206-298)||(5724682-5724774)
chr6 (206-309)||(765427-765530)
chr6 (206-309)||(4910849-4910952)
chr6 (206-302)||(26280546-26280642)
chr6 (240-309)||(16540082-16540151)
chr6 (208-307)||(6654133-6654232)
chr6 (250-309)||(7952750-7952809)
chr6 (231-309)||(30927009-30927087)
chr6 (210-298)||(25195418-25195504)
chr6 (206-309)||(1485187-1485291)
chr6 (221-285)||(2008567-2008631)
chr6 (265-309)||(6895991-6896035)
chr6 (206-285)||(2008403-2008482)
chr6 (230-296)||(35098228-35098294)
chr6 (219-308)||(35098500-35098589)
chr6 (245-309)||(852512-852576)
[»] scaffold0168 (1 HSPs)
scaffold0168 (206-309)||(31767-31870)
[»] chr1 (18 HSPs)
chr1 (206-302)||(28083936-28084032)
chr1 (206-309)||(31362246-31362345)
chr1 (210-302)||(6021749-6021841)
chr1 (217-305)||(1514296-1514383)
chr1 (206-290)||(47321966-47322050)
chr1 (267-302)||(11049252-11049287)
chr1 (210-303)||(32088620-32088713)
chr1 (272-309)||(7524120-7524157)
chr1 (269-309)||(28287377-28287417)
chr1 (269-309)||(51500875-51500915)
chr1 (242-309)||(3016140-3016206)
chr1 (266-309)||(30557505-30557548)
chr1 (219-300)||(12655198-12655280)
chr1 (268-309)||(36780157-36780199)
chr1 (240-300)||(18325439-18325500)
chr1 (240-293)||(30220267-30220320)
chr1 (252-309)||(48549053-48549110)
chr1 (221-309)||(30995998-30996086)
[»] chr5 (15 HSPs)
chr5 (206-309)||(18851123-18851226)
chr5 (248-309)||(9818717-9818778)
chr5 (206-302)||(6951353-6951448)
chr5 (208-292)||(27374349-27374433)
chr5 (242-299)||(38845761-38845819)
chr5 (206-302)||(34250399-34250495)
chr5 (206-309)||(14299271-14299374)
chr5 (206-309)||(22226277-22226380)
chr5 (265-309)||(22572445-22572489)
chr5 (245-305)||(31906239-31906299)
chr5 (265-309)||(38845443-38845487)
chr5 (210-305)||(11648027-11648122)
chr5 (210-309)||(11132826-11132926)
chr5 (240-309)||(36639912-36639981)
chr5 (245-300)||(3970450-3970506)
[»] chr3 (16 HSPs)
chr3 (206-307)||(1441424-1441525)
chr3 (206-308)||(44958648-44958750)
chr3 (207-302)||(32523388-32523484)
chr3 (240-302)||(7717369-7717431)
chr3 (240-309)||(35058336-35058405)
chr3 (265-309)||(35058067-35058111)
chr3 (219-299)||(41115413-41115493)
chr3 (219-309)||(36302139-36302227)
chr3 (210-309)||(54596763-54596862)
chr3 (242-299)||(23290269-23290327)
chr3 (209-259)||(48410903-48410953)
chr3 (240-309)||(5406881-5406950)
chr3 (205-309)||(35264452-35264556)
chr3 (265-309)||(40147891-40147935)
chr3 (210-282)||(41596204-41596275)
chr3 (206-302)||(44771635-44771731)
[»] chr7 (15 HSPs)
chr7 (210-309)||(41386856-41386955)
chr7 (206-309)||(27571803-27571906)
chr7 (227-300)||(40422754-40422828)
chr7 (205-309)||(45004960-45005064)
chr7 (210-305)||(5489891-5489986)
chr7 (206-309)||(40491519-40491622)
chr7 (223-297)||(36270938-36271012)
chr7 (265-302)||(17111857-17111894)
chr7 (206-302)||(28725100-28725196)
chr7 (206-258)||(12306675-12306727)
chr7 (245-300)||(15903580-15903635)
chr7 (209-252)||(17111819-17111862)
chr7 (225-273)||(23441307-23441355)
chr7 (265-297)||(26984533-26984565)
chr7 (265-309)||(30182337-30182381)
[»] chr2 (19 HSPs)
chr2 (205-298)||(2002747-2002840)
chr2 (206-309)||(10644545-10644647)
chr2 (206-305)||(16518720-16518819)
chr2 (206-309)||(42740918-42741021)
chr2 (219-283)||(680344-680408)
chr2 (206-302)||(30503150-30503246)
chr2 (265-309)||(43501125-43501169)
chr2 (205-299)||(11510893-11510988)
chr2 (240-302)||(31453358-31453420)
chr2 (206-252)||(43501084-43501130)
chr2 (210-259)||(7630361-7630410)
chr2 (240-309)||(22535973-22536042)
chr2 (206-302)||(10618989-10619085)
chr2 (265-299)||(21234576-21234610)
chr2 (263-300)||(44810372-44810410)
chr2 (219-280)||(32777924-32777985)
chr2 (240-309)||(33019197-33019266)
chr2 (240-300)||(37561681-37561742)
chr2 (265-302)||(42982544-42982581)
[»] scaffold0024 (1 HSPs)
scaffold0024 (219-300)||(23643-23724)
[»] scaffold0361 (1 HSPs)
scaffold0361 (240-284)||(14179-14223)


Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 21)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 309
Target Start/End: Original strand, 32927627 - 32927936
Alignment:
1 ccaattttgtcggaatcaagtgaaaaaaagttactgattttgtgnnnnnnnnnnnnnnnnn-ggaaaggggggatattcttctccgacgcaacaagctat 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||                  |||||| | |||||||||||||||||||||||||||||    
32927627 ccaattttgtcggaatcaagtgaaaaaaagttactgattttgtgttttttttttttttttttggaaagtgtggatattcttctccgacgcaacaagctat 32927726  T
100 aatcaatgatctcaagctctctgtttcagaggttttgtttgtttttgtgctttatgggttttagtggaaagtaatttttcattctgatatgcctgatccc 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32927727 aatcaatgatctcaagctctctgtttcagaggttttgtttgtttttgtgctttatgggttttagtggaaagtaatttttcattctgatatgcctgatccc 32927826  T
200 tttcaagtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttg 299  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32927827 tttcaagtagaattgactctgacatgtttggttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttg 32927926  T
300 attatagaat 309  Q
    ||||||||||    
32927927 attatagaat 32927936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 237 - 307
Target Start/End: Complemental strand, 44141163 - 44141093
Alignment:
237 tccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattataga 307  Q
    ||||||||||||||||||||||| | | |||||||||||||||| |||||||||||| |||||||| ||||    
44141163 tccagtagaattgattttgcctccaaaattgattctacttgaagttaggatttgtagtttttgattctaga 44141093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 265 - 309
Target Start/End: Complemental strand, 15677901 - 15677857
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    ||||||||||||||||||||||||| |||||||||||||||||||    
15677901 ttgattctacttgaagctaggatttatagcttttgattatagaat 15677857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 309
Target Start/End: Complemental strand, 16972208 - 16972105
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||| || |||||| || | |||| || |||||||||||||||||||  | |||||||| || |||||||||| |||||||| |||| ||| ||    
16972208 gtagaattgattcagacatgattggatgctatcgagtagaattgattttgccttcagagttgattgtatttgaagctagaatttgtagtttttaatttta 16972109  T
306 gaat 309  Q
    ||||    
16972108 gaat 16972105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 240 - 302
Target Start/End: Original strand, 37684380 - 37684442
Alignment:
240 agtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||||||||||||| ||| | | |||||||||||||||| |||||||||| ||||||||||    
37684380 agtagaattgattttgtctccagaattgattctacttgaagttaggatttgtggcttttgatt 37684442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 205 - 283
Target Start/End: Original strand, 42455852 - 42455930
Alignment:
205 agtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagcta 283  Q
    ||||||||||| | |||||||||| ||||||||  ||||| ||||||| |||||| ||| |||||||||||||| ||||    
42455852 agtagaattgattttgacatgtttggttgcttttgagtaggattgattctgcctccataattgattctacttgatgcta 42455930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 265 - 309
Target Start/End: Original strand, 35494990 - 35495034
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||||| ||||||||||||||||||||||||||| ||||||    
35494990 ttgattctacatgaagctaggatttgtagcttttgattctagaat 35495034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 242 - 309
Target Start/End: Complemental strand, 4663011 - 4662944
Alignment:
242 tagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    ||||||||||||||| ||   | || |||||||||||||||||||||||||||||||| || ||||||    
4663011 tagaattgattttgcatccggaatttattctacttgaagctaggatttgtagcttttgtttctagaat 4662944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 243 - 309
Target Start/End: Original strand, 10367973 - 10368039
Alignment:
243 agaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    ||||||||||| ||||| | | ||| |||||||||| ||||||||||| ||||||||||| ||||||    
10367973 agaattgatttcgcctccacaattggttctacttgaggctaggatttgcagcttttgattctagaat 10368039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 221 - 302
Target Start/End: Complemental strand, 26100276 - 26100194
Alignment:
221 acatgtttagttgctttccagtagaattgattttgc-ctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||||| ||||||| | ||||||||||| ||||  ||| | | ||| ||||| ||||||||||||||||||||||||||||    
26100276 acatgtttggttgcttccaagtagaattgactttggtctctagaattggttctatttgaagctaggatttgtagcttttgatt 26100194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 210 - 297
Target Start/End: Original strand, 7644510 - 7644596
Alignment:
210 aattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttt 297  Q
    |||||| |||||||| ||| |||||||||  |||||||||||| ||  |  | | |||||||||||| ||||||||||||||||||||    
7644510 aattgattctgacat-tttggttgctttcgtgtagaattgattatggatttagaattgattctacttaaagctaggatttgtagcttt 7644596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 206 - 309
Target Start/End: Complemental strand, 13384798 - 13384695
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||| |||||||||||| |||| | || ||| |||||  || |  ||| | | ||||||||| |||||||||  ||||||||||||||||| ||    
13384798 gtagaattgattctgacatgtttggttgttgtcgagtcgaatttgttctttctccaaaattgattctatttgaagctaaaatttgtagcttttgattcta 13384699  T
306 gaat 309  Q
    ||||    
13384698 gaat 13384695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 240 - 299
Target Start/End: Original strand, 38868473 - 38868532
Alignment:
240 agtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttg 299  Q
    |||| |||||||  |||||| | | ||||||||||||||||||| |||||||||||||||    
38868473 agtaaaattgatgatgcctctaaaattgattctacttgaagctaagatttgtagcttttg 38868532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 231 - 305
Target Start/End: Complemental strand, 11572577 - 11572503
Alignment:
231 ttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||  ||||||||||||||| | |  ||| |||||| ||||||||||||  |||||||| |||||||||||    
11572577 ttgcttttaagtagaattgattttacttacataattgattatacttgaagctaaaatttgtagattttgattata 11572503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 248 - 300
Target Start/End: Complemental strand, 1836315 - 1836262
Alignment:
248 tgattttgcctcaatagttgattcta-cttgaagctaggatttgtagcttttga 300  Q
    |||||||||||| | | ||||||||| |||||||||||||| ||||||||||||    
1836315 tgattttgcctctaaaattgattctaacttgaagctaggatgtgtagcttttga 1836262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 218 - 255
Target Start/End: Original strand, 7533750 - 7533787
Alignment:
218 ctgacatgtttagttgctttccagtagaattgattttg 255  Q
    ||||||||||| ||||||||| ||||||||||||||||    
7533750 ctgacatgtttggttgctttcaagtagaattgattttg 7533787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 206 - 283
Target Start/End: Original strand, 35495201 - 35495278
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagcta 283  Q
    |||||||||| | |||||||||| ||| || |  | ||||||| |||||||||| | | |||||||||||||||||||    
35495201 gtagaattgattttgacatgttttgtttctctaaattagaattaattttgcctctagaattgattctacttgaagcta 35495278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Original strand, 4950459 - 4950503
Alignment:
240 agtagaattgattttgcctcaatagttgattctacttgaagctag 284  Q
    |||||||||||||||||||||| | ||||||  ||||||||||||    
4950459 agtagaattgattttgcctcaaaaattgattagacttgaagctag 4950503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 245 - 300
Target Start/End: Complemental strand, 11791839 - 11791783
Alignment:
245 aattgattttgcctcaatagttgattctac-ttgaagctaggatttgtagcttttga 300  Q
    |||||| |||||||| |||  ||||||||| || |||||||||||||||||||||||    
11791839 aattgaatttgcctccataactgattctaccttcaagctaggatttgtagcttttga 11791783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 298
Target Start/End: Original strand, 26668493 - 26668585
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagctttt 298  Q
    |||||||||| ||| ||||||||  ||  | || ||||||||||||| |||||| ||| |||||||||||| || |||  |||||||| ||||    
26668493 gtagaattgattctaacatgtttgattcttgtcgagtagaattgattctgcctccataattgattctacttaaaactacaatttgtagttttt 26668585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 265 - 309
Target Start/End: Complemental strand, 32994327 - 32994283
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    ||||||||||||||||||| ||||| |||||||||| | ||||||    
32994327 ttgattctacttgaagctatgatttctagcttttgagtctagaat 32994283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 26)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 206 - 309
Target Start/End: Original strand, 35065004 - 35065107
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||| | |||||| ||| ||||||||| |||||||||||||||||||||||| |||||| ||||||||||||| ||||||  ||||||||| ||    
35065004 gtagaattgattatgacatttttggttgctttcgagtagaattgattttgcctcaataattgattttacttgaagctagtatttgtgacttttgattcta 35065103  T
306 gaat 309  Q
    ||||    
35065104 gaat 35065107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 220 - 309
Target Start/End: Complemental strand, 32818500 - 32818411
Alignment:
220 gacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    ||||| ||| ||| ||||| |||||||||||||||||||| | | ||||||||| |||||||||| ||||||||||||||||| ||||||    
32818500 gacatatttggtttctttcgagtagaattgattttgcctccagaattgattctatttgaagctagaatttgtagcttttgattctagaat 32818411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 237 - 307
Target Start/End: Complemental strand, 50061741 - 50061671
Alignment:
237 tccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattataga 307  Q
    ||||||||||||||||||||||| | | |||||||||||||||| |||||||||||| |||||||| ||||    
50061741 tccagtagaattgattttgcctccaaaattgattctacttgaagttaggatttgtagtttttgattctaga 50061671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 210 - 302
Target Start/End: Complemental strand, 54705531 - 54705438
Alignment:
210 aattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattct-acttgaagctaggatttgtagcttttgatt 302  Q
    |||||| || ||||||||| ||||||  | |||| ||||||||||||||||||| ||||| || ||||||||||||| ||||||||||||||||    
54705531 aattgattcagacatgtttggttgctcacaagtataattgattttgcctcaataattgatactaacttgaagctagggtttgtagcttttgatt 54705438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 207 - 297
Target Start/End: Original strand, 25318989 - 25319080
Alignment:
207 tagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattct-acttgaagctaggatttgtagcttt 297  Q
    ||||||||| | |||||||||| |||||| || |||||||||||||||| ||| | | |||||||| |||||||| ||||||||||||||||    
25318989 tagaattgattttgacatgtttggttgctctcgagtagaattgattttgtctccagaattgattctaacttgaaggtaggatttgtagcttt 25319080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 240 - 305
Target Start/End: Original strand, 26617443 - 26617508
Alignment:
240 agtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||||||||||||| | |  ||||||||||||||||||| || |||||||||||||||||    
26617443 agtagaattgattttgcctccaaaaatgattctacttgaagctagaatctgtagcttttgattata 26617508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 217 - 302
Target Start/End: Complemental strand, 46344964 - 46344880
Alignment:
217 tctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||||||||| ||||||||| |||| ||||||||||||||| ||| || ||||||||||||| ||| ||||  |||||||||||    
46344964 tctgacatgtttggttgctttcaagtataattgattttgcctccataatt-attctacttgaagttagaatttccagcttttgatt 46344880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 221 - 302
Target Start/End: Complemental strand, 49138891 - 49138811
Alignment:
221 acatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||||| |||| |||| |||| ||||||||||||||| | | || ||||||||||||||||||||||||| |||||||||    
49138891 acatgtttggttgttttcaagtaaaattgattttgcctccaaactt-attctacttgaagctaggatttgtaacttttgatt 49138811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 219 - 309
Target Start/End: Original strand, 9134564 - 9134654
Alignment:
219 tgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    ||||||||||||||| | || ||| ||||||||||| | || | | ||||| |||||||||||||  ||||||||||||||||| ||||||    
9134564 tgacatgtttagttgttatcgagtggaattgattttacttccagaattgatcctacttgaagctaaaatttgtagcttttgattttagaat 9134654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 219 - 300
Target Start/End: Complemental strand, 33560702 - 33560620
Alignment:
219 tgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattct-acttgaagctaggatttgtagcttttga 300  Q
    |||||||||| |||||| || |||||||||||||||||||| | | |||||||| ||   |||||||||||||||||||||||    
33560702 tgacatgtttggttgctctcgagtagaattgattttgcctctagaattgattctaaccgaaagctaggatttgtagcttttga 33560620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 247 - 300
Target Start/End: Complemental strand, 11271641 - 11271587
Alignment:
247 ttgattttgcctcaatagttgattcta-cttgaagctaggatttgtagcttttga 300  Q
    ||||||||||||| | | ||||||||| |||||||||||||||||||||||||||    
11271641 ttgattttgcctccagaattgattctaacttgaagctaggatttgtagcttttga 11271587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 221 - 298
Target Start/End: Original strand, 43868092 - 43868169
Alignment:
221 acatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagctttt 298  Q
    |||||||| ||||||||| ||||||||| |||||| ||| | | ||||||||| |||||  || ||||||||||||||    
43868092 acatgtttggttgctttctagtagaattaattttgtctccacaattgattctatttgaaattaagatttgtagctttt 43868169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 309
Target Start/End: Complemental strand, 8604707 - 8604663
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    ||||||||||||||||||| ||||||||||||| |||| ||||||    
8604707 ttgattctacttgaagctaagatttgtagctttcgattctagaat 8604663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 309
Target Start/End: Original strand, 9064187 - 9064275
Alignment:
221 acatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||| |||| | || | ||||||| | |||||| | ||| ||||||||||||||| |||| |||||||| |||||||| ||||||    
9064187 acatgtttggttgttgtcgaatagaattaaatttgccaccataattgattctacttgaaactagaatttgtagtttttgattctagaat 9064275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 305
Target Start/End: Original strand, 30357512 - 30357552
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    ||||||||||||||||||  |||||||||||||||||||||    
30357512 ttgattctacttgaagctgtgatttgtagcttttgattata 30357552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 309
Target Start/End: Complemental strand, 55187047 - 55187003
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||||||||||| ||||||||||| ||||| ||||||||||    
55187047 ttgattctacttgaagttaggatttgtaacttttaattatagaat 55187003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 243 - 298
Target Start/End: Complemental strand, 29779161 - 29779106
Alignment:
243 agaattgattttgcctcaatagttgattctacttgaagctaggatttgtagctttt 298  Q
    |||||||||||||| |  | | |||||||||||||||||||| |||||||||||||    
29779161 agaattgattttgcttgtagaattgattctacttgaagctagaatttgtagctttt 29779106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 210 - 309
Target Start/End: Complemental strand, 39733777 - 39733679
Alignment:
210 aattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||| |||||||| ||| |||| | || |||| |||| ||| |||||| ||| ||||||||||||| || ||  ||||||||||||||||| ||||||    
39733777 aattgattctgacatattttgttgttatcaagtataatttattctgcctccataattgattctacttg-agttacaatttgtagcttttgattgtagaat 39733679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 221 - 302
Target Start/End: Original strand, 8330071 - 8330153
Alignment:
221 acatgtttagttgctttccagtagaattgattttgcctcaatagttgattcta-cttgaagctaggatttgtagcttttgatt 302  Q
    |||||||| |||||| || |||| |||||||| |||||| ||| | ||||||| ||||||||||| | ||| |||||||||||    
8330071 acatgtttggttgctctcaagtaaaattgattctgcctccataatggattctaacttgaagctagaaattggagcttttgatt 8330153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 292
Target Start/End: Complemental strand, 49138979 - 49138894
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgta 292  Q
    |||||||||| |||||||||||| |||| |||| |||| |||||||| |||||  | || |  |||||||||||| |||||||||||    
49138979 gtagaattgattctgacatgtttggttgttttcaagtaaaattgattgtgcctgca-agcttgttctacttgaagataggatttgta 49138894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 302
Target Start/End: Original strand, 22250166 - 22250263
Alignment:
205 agtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    ||||||||| | |||||||||||| |||| | || | ||||||||||||||| || |   ||| ||||||||||||| || | ||| |||||||||||    
22250166 agtagaattcattctgacatgtttggttgttctcaattagaattgattttgcatctaggattggttctacttgaagcaagaaattgaagcttttgatt 22250263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 242 - 307
Target Start/End: Complemental strand, 41370118 - 41370053
Alignment:
242 tagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattataga 307  Q
    |||||||||||||  ||| | |||||||||||||||||| |||||||| ||| |||| ||| ||||    
41370118 tagaattgattttaactctagagttgattctacttgaagttaggatttatagttttttattctaga 41370053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 298
Target Start/End: Original strand, 16551898 - 16551990
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagctttt 298  Q
    |||||||||| |||||||||| | |||||| || | ||||  ||||| |||||| |   | |||||| |||||||||||||||||||| ||||    
16551898 gtagaattgattctgacatgtatggttgctgtcgaatagagctgattctgcctctaggatggattctccttgaagctaggatttgtagttttt 16551990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 265 - 305
Target Start/End: Original strand, 30357647 - 30357687
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    ||||||||| ||||||||| ||| |||||||||||||||||    
30357647 ttgattctaattgaagctatgatctgtagcttttgattata 30357687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 204 - 284
Target Start/End: Complemental strand, 48045847 - 48045767
Alignment:
204 aagtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctag 284  Q
    |||||||||||| || ||||||||| ||||||||| |||| || | |||||||| | | | || |||| ||||||||||||    
48045847 aagtagaattgattcggacatgtttggttgctttcaagtaaaactaattttgccaccagaatttattcgacttgaagctag 48045767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 302
Target Start/End: Complemental strand, 53713669 - 53713609
Alignment:
242 tagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    ||||||| ||||||  |||| | || ||| |||||||||||| ||||||||||||||||||    
53713669 tagaattaattttgtttcaagaattaattttacttgaagctacgatttgtagcttttgatt 53713609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 57; Significance: 8e-24; HSPs: 16)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 206 - 298
Target Start/End: Complemental strand, 5724774 - 5724682
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagctttt 298  Q
    |||||||||| |||||||||||| | |||||||  ||||||||||||||||||| | | |||||||||||||||||||||||||||| |||||    
5724774 gtagaattgattctgacatgtttggatgctttcaggtagaattgattttgcctccaaaattgattctacttgaagctaggatttgtaactttt 5724682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 206 - 309
Target Start/End: Complemental strand, 765530 - 765427
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||| |||||| ||||| ||||||||  ||||||| || ||||| ||||| | ||||||||||||||||||| |||||||||||||||||| ||    
765530 gtagaattgattctgacgtgtttggttgcttttaagtagaactggttttggctcaagaattgattctacttgaagctatgatttgtagcttttgattcta 765431  T
306 gaat 309  Q
    ||||    
765430 gaat 765427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 206 - 309
Target Start/End: Original strand, 4910849 - 4910952
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||| |||||||||||| ||||   || | ||||||||||| |||||||| | ||||||||||||||||||| |||||||||||||||||| ||    
4910849 gtagaattgattctgacatgtttggttgtcgtcaattagaattgattctgcctcaaaaattgattctacttgaagctatgatttgtagcttttgattcta 4910948  T
306 gaat 309  Q
    ||||    
4910949 gaat 4910952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 206 - 302
Target Start/End: Original strand, 26280546 - 26280642
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||||||| | ||||||||||  ||| |||   ||||||||||||||||||||| | ||||||| |||||||||||| |||||||| ||||||||    
26280546 gtagaattgattttgacatgtttgattgttttttggtagaattgattttgcctcaagaattgattccacttgaagctagaatttgtagtttttgatt 26280642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 240 - 309
Target Start/End: Original strand, 16540082 - 16540151
Alignment:
240 agtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||| |||||||| || ||| | | |||||||||||||||||||||||||||||||||||||||| ||||    
16540082 agtaaaattgattctgtctccaaaattgattctacttgaagctaggatttgtagcttttgattattgaat 16540151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 208 - 307
Target Start/End: Complemental strand, 6654232 - 6654133
Alignment:
208 agaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattataga 307  Q
    |||||||| | || ||||||| |||||| |  ||||||||||||||| |||  | | || ||||||||||||||||||||||||||||||| ||| ||||    
6654232 agaattgattatgtcatgtttggttgctattgagtagaattgatttttccttcagaattaattctacttgaagctaggatttgtagcttttaattctaga 6654133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 250 - 309
Target Start/End: Complemental strand, 7952809 - 7952750
Alignment:
250 attttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||||| | | || |||||||||||||| |||||||||||||||||||| ||||||    
7952809 attttgcctccaaaatttattctacttgaagcgaggatttgtagcttttgattctagaat 7952750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 231 - 309
Target Start/End: Original strand, 30927009 - 30927087
Alignment:
231 ttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||| | || ||| |||||||| || | | |||||| |||||||||||| |||| ||||||||||||||||||||    
30927009 ttgctttcgattataatagattttgcttccagaattgattatacttgaagctaagattcgtagcttttgattatagaat 30927087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 210 - 298
Target Start/End: Complemental strand, 25195504 - 25195418
Alignment:
210 aattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagctttt 298  Q
    |||||| |||||||||||| |||||| || |||| |||||||| ||||||   | |||||||||||||||||  |||||||||| ||||    
25195504 aattgattctgacatgtttggttgctatcgagtataattgattctgcctccggaattgattctacttgaagc--ggatttgtagttttt 25195418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 309
Target Start/End: Complemental strand, 1485291 - 1485187
Alignment:
206 gtagaattgactct-gacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattat 304  Q
    |||||||||| ||| |||||||||  ||||| |  ||||||||| |||||||||  | | ||||||||||||||| |||| | ||| ||||||||||| |    
1485291 gtagaattgattcttgacatgtttgtttgctcttgagtagaattaattttgcctttagaattgattctacttgaatctagaaattggagcttttgattct 1485192  T
305 agaat 309  Q
    |||||    
1485191 agaat 1485187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 285
Target Start/End: Complemental strand, 2008631 - 2008567
Alignment:
221 acatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctagg 285  Q
    |||||||| ||||||||| |||||||||||||||||||| | | || ||||||| ||| ||||||    
2008631 acatgtttggttgctttctagtagaattgattttgcctccagaattaattctacgtgatgctagg 2008567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 309
Target Start/End: Complemental strand, 6896035 - 6895991
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||||| ||||| ||||||||||||||||||||| ||||||    
6896035 ttgattctacctgaagttaggatttgtagcttttgattctagaat 6895991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 206 - 285
Target Start/End: Complemental strand, 2008482 - 2008403
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctagg 285  Q
    |||||||||  ||||||||||||  ||| |||| ||||||||| |||||| ||| ||| |  ||||||||||||||||||    
2008482 gtagaattgtttctgacatgtttgattgttttcgagtagaattcattttgtctccataatcaattctacttgaagctagg 2008403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 230 - 296
Target Start/End: Complemental strand, 35098294 - 35098228
Alignment:
230 gttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagctt 296  Q
    ||||||||| | |||||||||||||||||  | | ||||||||| |||||||||| | |||||||||    
35098294 gttgctttcaactagaattgattttgcctacaaaattgattctaattgaagctagaaattgtagctt 35098228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 219 - 308
Target Start/End: Complemental strand, 35098589 - 35098500
Alignment:
219 tgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaa 308  Q
    |||||||||| ||| ||||  ||||||||||||||||| || |   |||||||||||| |  || |||||| |||||||||||| |||||    
35098589 tgacatgtttggttacttttgagtagaattgattttgcttccaggattgattctacttaatactgggatttttagcttttgattctagaa 35098500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 245 - 309
Target Start/End: Original strand, 852512 - 852576
Alignment:
245 aattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||| |||||||||| ||| ||||||| |||||||||||| | |||||| || ||||| ||||||    
852512 aatttattttgcctccataattgattcaacttgaagctagaaattgtaggttctgattctagaat 852576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 206 - 309
Target Start/End: Original strand, 31767 - 31870
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||| |||||||||||| |||| | || |||| |||||||| |||||| | | |||||| |||||||||||||||||||||||||||||||||     
31767 gtagaattgattctgacatgtttggttgttgtcgagtaaaattgattctgcctccaaaattgattatacttgaagctaggatttgtagcttttgattatt 31866  T
306 gaat 309  Q
    ||||    
31867 gaat 31870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 18)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 206 - 302
Target Start/End: Complemental strand, 28084032 - 28083936
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||||||| |||||||| ||| |||| |||| |||||||||||||||| ||   || |||||||||||||||||||| |||||||||||||||||    
28084032 gtagaattgattctgacatatttggttgttttcgagtagaattgattttgtcttcgtaattgattctacttgaagctagaatttgtagcttttgatt 28083936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 206 - 309
Target Start/End: Complemental strand, 31362345 - 31362246
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    ||||||| |||||| |||||||| |||||||||  ||||||||||||||||||| ||| |||||||    ||||| ||| ||||||||||||||||| ||    
31362345 gtagaatcgactctaacatgtttggttgctttcatgtagaattgattttgcctccataattgattc----tgaagttagaatttgtagcttttgattcta 31362250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 210 - 302
Target Start/End: Original strand, 6021749 - 6021841
Alignment:
210 aattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||| | ||||| ||||  ||| |||| |||||||||||||||||||| | | | ||||||||||||||||||||| ||||||||||||||    
6021749 aattgattttgacaagtttgattgatttcaagtagaattgattttgcctctagaatcgattctacttgaagctaggatatgtagcttttgatt 6021841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 217 - 305
Target Start/End: Original strand, 1514296 - 1514383
Alignment:
217 tctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||||| |||||| || |||| || ||||| || ||| | | || ||||||||||||||||||||||||||||||| ||||||    
1514296 tctgacatgtttggttgctgtc-agtaaaactgattctgtctccaaaatttattctacttgaagctaggatttgtagctttttattata 1514383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 206 - 290
Target Start/End: Complemental strand, 47322050 - 47321966
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttg 290  Q
    |||||||||| | |||||||||| |||| | || ||||||||||||| ||| || ||| |||||| ||||||||||||| |||||    
47322050 gtagaattgattttgacatgttttgttgttgtcgagtagaattgattctgcttctataattgattatacttgaagctagaatttg 47321966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 267 - 302
Target Start/End: Original strand, 11049252 - 11049287
Alignment:
267 gattctacttgaagctaggatttgtagcttttgatt 302  Q
    ||||||||||||||||||||||||||||||||||||    
11049252 gattctacttgaagctaggatttgtagcttttgatt 11049287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 303
Target Start/End: Complemental strand, 32088713 - 32088620
Alignment:
210 aattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattct-acttgaagctaggatttgtagcttttgatta 303  Q
    |||||| | |||||||||| |||||| || ||||||||||||||| |||  | | |||||||| |||||||||||||||||  ||||||||||||    
32088713 aattgattttgacatgtttggttgctctcaagtagaattgatttt-cctacaaaattgattctaacttgaagctaggatttcgagcttttgatta 32088620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 272 - 309
Target Start/End: Original strand, 7524120 - 7524157
Alignment:
272 tacttgaagctaggatttgtagcttttgattatagaat 309  Q
    ||||||||| ||||||||||||||||||||||||||||    
7524120 tacttgaagttaggatttgtagcttttgattatagaat 7524157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 309
Target Start/End: Complemental strand, 28287417 - 28287377
Alignment:
269 ttctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    ||||||||||||| |||||||||||||||||||| ||||||    
28287417 ttctacttgaagcaaggatttgtagcttttgattttagaat 28287377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 309
Target Start/End: Complemental strand, 51500915 - 51500875
Alignment:
269 ttctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    ||||||||||| |||||||||||||||||||||| ||||||    
51500915 ttctacttgaacctaggatttgtagcttttgattctagaat 51500875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 242 - 309
Target Start/End: Original strand, 3016140 - 3016206
Alignment:
242 tagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    ||||||||||||||| | | || |||||||||||||||  ||| ||||||||||||||||| ||||||    
3016140 tagaattgattttgcttta-taattgattctacttgaacttagaatttgtagcttttgattctagaat 3016206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 266 - 309
Target Start/End: Original strand, 30557505 - 30557548
Alignment:
266 tgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||| ||||||||||||||||||| |||||||| ||||||    
30557505 tgattctagttgaagctaggatttgtagtttttgattctagaat 30557548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 219 - 300
Target Start/End: Original strand, 12655198 - 12655280
Alignment:
219 tgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattct-acttgaagctaggatttgtagcttttga 300  Q
    |||||||||||||||||||  |||||| | || |||||||| | | || ||||| |||||||||||| ||||||||| |||||    
12655198 tgacatgtttagttgctttggagtagattcgactttgcctctagaattaattctaacttgaagctagaatttgtagcatttga 12655280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 268 - 309
Target Start/End: Complemental strand, 36780199 - 36780157
Alignment:
268 attctacttgaagctaggattt-gtagcttttgattatagaat 309  Q
    ||||||||||||| |||||||| ||||||||||||||||||||    
36780199 attctacttgaagttaggattttgtagcttttgattatagaat 36780157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 300
Target Start/End: Complemental strand, 18325500 - 18325439
Alignment:
240 agtagaattgattttgcctcaatagttgattcta-cttgaagctaggatttgtagcttttga 300  Q
    |||||||||||||||||||| | |||| | |||| |||||||||||||||||  ||||||||    
18325500 agtagaattgattttgcctccaaagttaactctaacttgaagctaggatttgatgcttttga 18325439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 293
Target Start/End: Complemental strand, 30220320 - 30220267
Alignment:
240 agtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtag 293  Q
    ||||||||||||||||| |  ||| |||||||||||||||||||  ||||||||    
30220320 agtagaattgattttgcttgtataattgattctacttgaagctataatttgtag 30220267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 309
Target Start/End: Complemental strand, 48549110 - 48549053
Alignment:
252 tttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||| | | |||||||||||||||||||| | ||||||||| ||||| ||||||    
48549110 tttgcctccaaaattgattctacttgaagctagaaattgtagcttctgattctagaat 48549053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 309
Target Start/End: Original strand, 30995998 - 30996086
Alignment:
221 acatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    ||||||||  ||| |||| ||||| ||||||||| | | || | |||||||||||||||| || |||| |||| |||| ||||||||||    
30995998 acatgtttgtttggtttcaagtagtattgatttttctttaagaattgattctacttgaagttatgattagtagttttttattatagaat 30996086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 52; Significance: 8e-21; HSPs: 15)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 206 - 309
Target Start/End: Complemental strand, 18851226 - 18851123
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    ||||||||||||||||| ||||| |||||| || | ||||||||||  |  | | ||| ||||||||||||||||||| |||||||||||||||||||||    
18851226 gtagaattgactctgacgtgtttggttgctatcaattagaattgatcctatccctataattgattctacttgaagctatgatttgtagcttttgattata 18851127  T
306 gaat 309  Q
    ||||    
18851126 gaat 18851123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 248 - 309
Target Start/End: Original strand, 9818717 - 9818778
Alignment:
248 tgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||||||| ||| ||||||||||||||||||| |||||||||||||||||| ||||||    
9818717 tgattttgcctccataattgattctacttgaagctatgatttgtagcttttgattctagaat 9818778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 206 - 302
Target Start/End: Complemental strand, 6951448 - 6951353
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||||||| |||||||| ||||||| ||||| ||||||||  | || | ||| ||| |||||||||||||||| |||||||||||||||||||||    
6951448 gtagaattgattctgacatatttagttactttcgagtagaatc-agttcgtctctataattgattctacttgaagttaggatttgtagcttttgatt 6951353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 208 - 292
Target Start/End: Complemental strand, 27374433 - 27374349
Alignment:
208 agaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgta 292  Q
    |||||||  |||||||||||| |||| |||| ||||||||| ||||||||| || | |||||||||||||||| |||||||||||    
27374433 agaattgtttctgacatgtttggttgttttcaagtagaattaattttgccttaagaattgattctacttgaagttaggatttgta 27374349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 242 - 299
Target Start/End: Original strand, 38845761 - 38845819
Alignment:
242 tagaattgattttgcctcaatagttgattct-acttgaagctaggatttgtagcttttg 299  Q
    |||||||||||||||||| |||||||||||| |||||||||||| ||| ||||||||||    
38845761 tagaattgattttgcctctatagttgattctgacttgaagctagaattcgtagcttttg 38845819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 206 - 302
Target Start/End: Complemental strand, 34250495 - 34250399
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||||||  | |||||||||| ||| || |  ||||||||||||| |||||| | | |||||||||||||| ||||| | |||||||||||||||    
34250495 gtagaattgtttttgacatgtttggtttctctagagtagaattgattatgcctctagaattgattctacttgatgctagaaattgtagcttttgatt 34250399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 309
Target Start/End: Original strand, 14299271 - 14299374
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||| |||| ||| ||| |||| |||| | || |||||||||||| |  | | |||||||||||||||| |||||||||||| |||| ||| ||    
14299271 gtagaattgattctggcatatttggttgttttcgaataaaattgattttgcttttaaaattgattctacttgaagttaggatttgtagttttttattcta 14299370  T
306 gaat 309  Q
    ||||    
14299371 gaat 14299374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 309
Target Start/End: Complemental strand, 22226380 - 22226277
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||| |||||||||||| |||| | || | || |||||||||||  |   |  |||||||||||||||| ||| ||||||||||||||||| ||    
22226380 gtagaattgattctgacatgtttggttgttgtcgactaaaattgattttgttttgttgattgattctacttgaagatagtatttgtagcttttgatttta 22226281  T
306 gaat 309  Q
    ||||    
22226280 gaat 22226277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 309
Target Start/End: Complemental strand, 22572489 - 22572445
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||| | ||||||||| ||||||||||||||||||||||||||    
22572489 ttgattgttcttgaagctgggatttgtagcttttgattatagaat 22572445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 245 - 305
Target Start/End: Original strand, 31906239 - 31906299
Alignment:
245 aattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    ||||| |||| |||| ||| |||||| |||||||||||| |||||||| ||||||||||||    
31906239 aattgtttttacctctataattgattttacttgaagctatgatttgtaacttttgattata 31906299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 309
Target Start/End: Original strand, 38845443 - 38845487
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    ||||||||||||||||||| ||||||||| |||||||| ||||||    
38845443 ttgattctacttgaagctaagatttgtagtttttgattctagaat 38845487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 210 - 305
Target Start/End: Original strand, 11648027 - 11648122
Alignment:
210 aattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||| | ||||||||||  ||||| || ||||||||| ||| ||| |  | | ||||||||||||||||||| ||||||||  |||||||||||    
11648027 aattgattttgacatgtttgattgctgtcgagtagaatttattatgcatttaaaattgattctacttgaagctaagatttgtacattttgattata 11648122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 210 - 309
Target Start/End: Complemental strand, 11132926 - 11132826
Alignment:
210 aattgactctgacatgtttagttgctttccagtagaattgattttgcc-tcaatagttgattcta-cttgaagctaggatttgtagcttttgattataga 307  Q
    |||||||| |||||||||| |||||| || ||||||||| |||||| | |||| | ||||||||| ||||||||||  | ||||||||||| ||| ||||    
11132926 aattgactttgacatgtttggttgctctctagtagaatttattttggcgtcaaaa-ttgattctaacttgaagctacaaattgtagctttttattgtaga 11132828  T
308 at 309  Q
    ||    
11132827 at 11132826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 309
Target Start/End: Original strand, 36639912 - 36639981
Alignment:
240 agtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||||||||||||||| | | | |||||||||||||||| | | ||||||||| | ||| ||||||    
36639912 agtagaattgattttgcctccaaaatagattctacttgaagctggaaattgtagcttctaattctagaat 36639981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 245 - 300
Target Start/End: Complemental strand, 3970506 - 3970450
Alignment:
245 aattgattttgcctcaatagttgattctact-tgaagctaggatttgtagcttttga 300  Q
    ||||||||||||||| | | ||||||||| | ||||||||||| |||||||||||||    
3970506 aattgattttgcctccagaattgattctaatctgaagctaggaattgtagcttttga 3970450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 16)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 206 - 307
Target Start/End: Complemental strand, 1441525 - 1441424
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||| | |||||||||| ||| ||||  |||||||||||||||| ||| ||| | || |||||||||| |||||||||||||||||||||| ||    
1441525 gtagaattgagtttgacatgtttggtttcttttgagtagaattgattttgtctctataatcgactctacttgaaactaggatttgtagcttttgattcta 1441426  T
306 ga 307  Q
    ||    
1441425 ga 1441424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 206 - 308
Target Start/End: Complemental strand, 44958750 - 44958648
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||| |||||||||||| |||||| ||  |  |||||||||||||||| | ||||||||||||| || ||||| | ||| ||||||||||| ||    
44958750 gtagaattgattctgacatgtttggttgctctcagggggaattgattttgcctccagagttgattctactcgatgctagaaattggagcttttgattcta 44958651  T
306 gaa 308  Q
    |||    
44958650 gaa 44958648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 207 - 302
Target Start/End: Complemental strand, 32523484 - 32523388
Alignment:
207 tagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctactt-gaagctaggatttgtagcttttgatt 302  Q
    ||||||||| || ||| ||||| ||||||||| |||| ||| ||||||||||| ||| ||  |||||||| |||| |||||||||||||||||||||    
32523484 tagaattgattcagacttgtttggttgctttcgagtaaaatagattttgcctccataattatttctacttggaagttaggatttgtagcttttgatt 32523388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 240 - 302
Target Start/End: Complemental strand, 7717431 - 7717369
Alignment:
240 agtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||||||||||||||||| | | |||||||||||||||||||| | ||||||||| |||||    
7717431 agtagaattgattttgcctccagaattgattctacttgaagctagaaattgtagcttctgatt 7717369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 240 - 309
Target Start/End: Original strand, 35058336 - 35058405
Alignment:
240 agtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||||||||||||||||| | ||||||||||||| |||||| | ||  ||||||||||| ||||||    
35058336 agtagaattgattttgcctcaagaattgattctacttggagctagaaattcgagcttttgattctagaat 35058405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 265 - 309
Target Start/End: Original strand, 35058067 - 35058111
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||||| ||||||||||||||||||||||| ||||||||||    
35058067 ttgattctacatgaagctaggatttgtagcttttaattatagaat 35058111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 219 - 299
Target Start/End: Complemental strand, 41115493 - 41115413
Alignment:
219 tgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttg 299  Q
    |||||||||| | || |||  ||||||||||||||||| |  | | |||||||||||||||||||| ||||||||||||||    
41115493 tgacatgtttggatgttttaaagtagaattgattttgcttgtagaattgattctacttgaagctagaatttgtagcttttg 41115413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 219 - 309
Target Start/End: Original strand, 36302139 - 36302227
Alignment:
219 tgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||||||||||  ||| |||||||||||||||||||  | ||||||||||| ||||||||||   ||| || |||||||| ||||||    
36302139 tgacatgtttagttg--ttcaagtagaattgattttgccttcagagttgattctatttgaagctagagattggagattttgattttagaat 36302227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 210 - 309
Target Start/End: Original strand, 54596763 - 54596862
Alignment:
210 aattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||| | |||||||||| |||| |||| ||||||||||||| |||||| | |  ||||| || |||||| ||| ||||||| ||||| ||| ||||||    
54596763 aattgattatgacatgtttggttgttttcaagtagaattgattctgcctccaaaaatgattttatttgaagttagaatttgtaacttttaattttagaat 54596862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 242 - 299
Target Start/End: Original strand, 23290269 - 23290327
Alignment:
242 tagaattgattttgcctcaatagttgattct-acttgaagctaggatttgtagcttttg 299  Q
    ||||||||||| || ||| |||||||||||| ||||||| ||| |||||||||||||||    
23290269 tagaattgattatgtctctatagttgattctaacttgaaactatgatttgtagcttttg 23290327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 209 - 259
Target Start/End: Complemental strand, 48410953 - 48410903
Alignment:
209 gaattgactctgacatgtttagttgctttccagtagaattgattttgcctc 259  Q
    ||||||| ||||| ||||||  |||||||| ||||||||||||||||||||    
48410953 gaattgattctgagatgtttgattgctttcgagtagaattgattttgcctc 48410903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 309
Target Start/End: Original strand, 5406881 - 5406950
Alignment:
240 agtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||| ||||||||||||||| | | | ||||||||| |||||||| | | ||||||| ||||||||||||    
5406881 agtataattgattttgcctctagaatggattctactcgaagctagaaatggtagcttctgattatagaat 5406950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 309
Target Start/End: Complemental strand, 35264556 - 35264452
Alignment:
205 agtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattat 304  Q
    |||| |||||| ||| |||||||| |||||| || |  |||||||||| |||||| | |  |||||||||||||| |||| | ||  ||||||||||| |    
35264556 agtaaaattgattctcacatgtttggttgctctcgaagagaattgattctgcctccaaatatgattctacttgaaactagaaattagagcttttgattct 35264457  T
305 agaat 309  Q
    |||||    
35264456 agaat 35264452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 265 - 309
Target Start/End: Complemental strand, 40147935 - 40147891
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||||||| ||||||| ||||| ||||||||||| ||||||    
40147935 ttgattctacttcaagctagaatttggagcttttgattctagaat 40147891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 210 - 282
Target Start/End: Complemental strand, 41596275 - 41596204
Alignment:
210 aattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagct 282  Q
    |||||| |||||||||||| ||||||||| |  |||||| |||||||||| | |||| |||||||||| ||||    
41596275 aattgattctgacatgtttggttgctttcga-aagaattaattttgcctctagagtttattctacttgtagct 41596204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 302
Target Start/End: Original strand, 44771635 - 44771731
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||| ||| |||||||||||  | |||| ||  ||||||||| |||||||||   | |||||||||| | || |||| |||||||||||||||||    
44771635 gtagaactgattctgacatgttgggctgctatcaggtagaattggttttgcctccggaattgattctacctaaatctagaatttgtagcttttgatt 44771731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 15)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 210 - 309
Target Start/End: Complemental strand, 41386955 - 41386856
Alignment:
210 aattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||| ||||||||||||  |||||||| |||| |||||||||  |||  | | |||||||||||||||||||||||||||||||||| ||| ||||||    
41386955 aattgattctgacatgtttgattgctttcgagtataattgatttcaccttcagaattgattctacttgaagctaggatttgtagcttttaattctagaat 41386856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 206 - 309
Target Start/End: Original strand, 27571803 - 27571906
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||||||  ||||||||  ||||| || |||| |||||||||| |||||| | |||||||||||||||| ||| | ||| ||||||||||| ||    
27571803 gtagaattgactcctacatgtttgattgctctcgagtataattgattttacctcaagaattgattctacttgaagttagaaattggagcttttgattcta 27571902  T
306 gaat 309  Q
    ||||    
27571903 gaat 27571906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 227 - 300
Target Start/End: Original strand, 40422754 - 40422828
Alignment:
227 ttagttgctttccagtagaattgattttgcctcaatagttgattct-acttgaagctaggatttgtagcttttga 300  Q
    ||||||||| || |||||||||||||||||||||| | |||||||| |||||||| |||||||||| ||||||||    
40422754 ttagttgctctcaagtagaattgattttgcctcaagaattgattctaacttgaagttaggatttgtggcttttga 40422828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 205 - 309
Target Start/End: Original strand, 45004960 - 45005064
Alignment:
205 agtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattat 304  Q
    |||| |||||| | |||||||||| |||||| || | |||||||||||||||||  | | |||||||||||||||||||  | ||| ||  |||||||||    
45004960 agtataattgattttgacatgtttggttgctctcgaatagaattgattttgccttcagaattgattctacttgaagctaaaaattggaggctttgattat 45005059  T
305 agaat 309  Q
    |||||    
45005060 agaat 45005064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 210 - 305
Target Start/End: Complemental strand, 5489986 - 5489891
Alignment:
210 aattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||| ||| |||||||| ||||||    ||||||||| |||||||||| | | |||||||||||||| ||||| | ||| ||||||||||||||    
5489986 aattgattcttacatgtttggttgctcctgagtagaattaattttgcctccaaaattgattctacttgatgctagaaattggagcttttgattata 5489891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 309
Target Start/End: Original strand, 40491519 - 40491622
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||| ||| ||||| || ||||||||| |  | ||||||||||||||  | | |||| ||||||||||| || | |||||||||||||||| ||    
40491519 gtagaattgattctaacatggttggttgctttcgaagataattgattttgccttcagaattgactctacttgaagttaagttttgtagcttttgattcta 40491618  T
306 gaat 309  Q
    ||||    
40491619 gaat 40491622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 297
Target Start/End: Original strand, 36270938 - 36271012
Alignment:
223 atgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttt 297  Q
    |||||| ||| || || |||||||||||||||||||| | | || ||||||||||||| | ||||||||||||||    
36270938 atgtttggtttctctctagtagaattgattttgcctctagaatttattctacttgaagttgggatttgtagcttt 36271012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 265 - 302
Target Start/End: Original strand, 17111857 - 17111894
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    ||||||||||||||||||| ||||||||||||||||||    
17111857 ttgattctacttgaagctatgatttgtagcttttgatt 17111894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 206 - 302
Target Start/End: Complemental strand, 28725196 - 28725100
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctc-aatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||||||| |  ||||||||| |||| ||||   |||||||||||  ||||| |||| |||||| ||||||||||||| |||||||||||||||||    
28725196 gtagaattgatttagacatgtttggttgttttcgtttagaattgattcagcctccaata-ttgattatacttgaagctagaatttgtagcttttgatt 28725100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 258
Target Start/End: Original strand, 12306675 - 12306727
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcct 258  Q
    |||||||||| | |||||||||| |||||| || |||||||||||||||||||    
12306675 gtagaattgattttgacatgtttggttgctctcaagtagaattgattttgcct 12306727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 245 - 300
Target Start/End: Complemental strand, 15903635 - 15903580
Alignment:
245 aattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttga 300  Q
    ||||||||||||||| | | |||||| ||||||||| | |||||||||||||||||    
15903635 aattgattttgcctccaaaattgattatacttgaagttgggatttgtagcttttga 15903580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 209 - 252
Target Start/End: Original strand, 17111819 - 17111862
Alignment:
209 gaattgactctgacatgtttagttgctttccagtagaattgatt 252  Q
    ||||||| |||||||||||| ||||||||| |||||||||||||    
17111819 gaattgattctgacatgtttggttgctttcgagtagaattgatt 17111862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 23441355 - 23441307
Alignment:
225 gtttagttgctttccagtagaattgattttgcctcaatagttgattcta 273  Q
    ||||||||| |||| |||| ||||||||||||||| ||| |||||||||    
23441355 gtttagttgttttcaagtacaattgattttgcctccataattgattcta 23441307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 265 - 297
Target Start/End: Complemental strand, 26984565 - 26984533
Alignment:
265 ttgattctacttgaagctaggatttgtagcttt 297  Q
    ||||||||||||||||||| |||||||||||||    
26984565 ttgattctacttgaagctaagatttgtagcttt 26984533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 265 - 309
Target Start/End: Complemental strand, 30182381 - 30182337
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||||||||||||||  | ||||||||||||||| ||||||    
30182381 ttgattctacttgaagctaaaaattgtagcttttgattctagaat 30182337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 3e-17; HSPs: 19)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 205 - 298
Target Start/End: Complemental strand, 2002840 - 2002747
Alignment:
205 agtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagctttt 298  Q
    |||||||||||   ||||||  || ||||||||| |||||||||||||||||||| | |  |||||||||||||||||||||||||||| ||||    
2002840 agtagaattgatgttgacatacttggttgctttctagtagaattgattttgcctccagacctgattctacttgaagctaggatttgtagttttt 2002747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 206 - 309
Target Start/End: Original strand, 10644545 - 10644647
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||||||||||||||||   || |||| ||||||||||||| |||||| | | || ||||||||||||| || ||||||||| |||| ||||||    
10644545 gtagaattgactctgacatgtttgtctg-tttcgagtagaattgattctgcctccaaaatttattctacttgaagttaagatttgtagtttttcattata 10644643  T
306 gaat 309  Q
    ||||    
10644644 gaat 10644647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 206 - 305
Target Start/End: Original strand, 16518720 - 16518819
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||| ||||| |||||| |||||||| ||   |||||| |||||| || | | ||||||||||| |||| ||||||||||||||||||||||||    
16518720 gtagaattgattctgatatgtttggttgcttttcaaatgaattggttttgcttccagaattgattctactagaagataggatttgtagcttttgattata 16518819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 206 - 309
Target Start/End: Original strand, 42740918 - 42741021
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattata 305  Q
    |||||||||| | |||||||||  || |||||| | ||| | ||| ||| |||| ||| ||||||||||||||||||| |||||||||||||||||| ||    
42740918 gtagaattgattttgacatgttccgtagctttcgaataggactgaattttcctccataattgattctacttgaagctaagatttgtagcttttgattcta 42741017  T
306 gaat 309  Q
    ||||    
42741018 gaat 42741021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 219 - 283
Target Start/End: Complemental strand, 680408 - 680344
Alignment:
219 tgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagcta 283  Q
    |||||||||||||||||||| | ||||| |||||||||||| | | |||||||||||||||||||    
680408 tgacatgtttagttgctttcgaatagaactgattttgcctccagaattgattctacttgaagcta 680344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 206 - 302
Target Start/End: Original strand, 30503150 - 30503246
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||||||| ||| |||||||   ||| |||| || |||| |||||||||||| | | ||||||||||||||||| |||||| |||||||||||||    
30503150 gtagaattgattctaacatgttcgattgatttcaagaagaaatgattttgcctccaaaattgattctacttgaagccaggattcgtagcttttgatt 30503246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 265 - 309
Target Start/End: Original strand, 43501125 - 43501169
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    ||||||||||||||| |||||||||||||||||||||| ||||||    
43501125 ttgattctacttgaaactaggatttgtagcttttgattttagaat 43501169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 205 - 299
Target Start/End: Original strand, 11510893 - 11510988
Alignment:
205 agtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattcta-cttgaagctaggatttgtagcttttg 299  Q
    ||||||||||  | ||| |||||| | || |||| |||||||||||||||||||| ||| ||||||||| ||||||||||| ||||| || |||||    
11510893 agtagaattggttttgatatgtttggatgttttcgagtagaattgattttgcctccatatttgattctatcttgaagctagaatttggagtttttg 11510988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 240 - 302
Target Start/End: Original strand, 31453358 - 31453420
Alignment:
240 agtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    ||||||||| |||||||||| ||| |||||||||||||||||||  ||||||  |||||||||    
31453358 agtagaatttattttgcctctataattgattctacttgaagctaaaatttgttccttttgatt 31453420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 43501084 - 43501130
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgatt 252  Q
    |||||||||| |||||||||||| ||||||||| |||||||||||||    
43501084 gtagaattgattctgacatgtttggttgctttcaagtagaattgatt 43501130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 210 - 259
Target Start/End: Original strand, 7630361 - 7630410
Alignment:
210 aattgactctgacatgtttagttgctttccagtagaattgattttgcctc 259  Q
    |||||| | |||||||||| ||||||||| ||||||||||||||||||||    
7630361 aattgattttgacatgtttggttgctttcaagtagaattgattttgcctc 7630410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 240 - 309
Target Start/End: Original strand, 22535973 - 22536042
Alignment:
240 agtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||||||||||||||||||  | | |||||||||||||||  ||| ||||| ||||||||||| ||||||    
22535973 agtagaattgattttgcctttagaattgattctacttgaatttagaatttgaagcttttgattttagaat 22536042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 302
Target Start/End: Complemental strand, 10619085 - 10618989
Alignment:
206 gtagaattgactctgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||||||| | | ||| |||| ||||||||||| | |||||||||||||||  | | ||||||||| |||||||||| | ||  |||||||||||    
10619085 gtagaattgagtataacaagtttggttgctttccacttgaattgattttgcctttagaattgattctagttgaagctagaaattagagcttttgatt 10618989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 299
Target Start/End: Complemental strand, 21234610 - 21234576
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttg 299  Q
    |||||||||||||||||||| ||||||||||||||    
21234610 ttgattctacttgaagctagaatttgtagcttttg 21234576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 300
Target Start/End: Original strand, 44810372 - 44810410
Alignment:
263 agttgattcta-cttgaagctaggatttgtagcttttga 300  Q
    ||||||||||| |||||||||||||||||||||||||||    
44810372 agttgattctaacttgaagctaggatttgtagcttttga 44810410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 219 - 280
Target Start/End: Original strand, 32777924 - 32777985
Alignment:
219 tgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaag 280  Q
    |||||||||| |||| ||||  ||||||||||||||||||| ||| || |||| ||||||||    
32777924 tgacatgtttggttgttttcgtgtagaattgattttgcctccataatttattcaacttgaag 32777985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 309
Target Start/End: Complemental strand, 33019266 - 33019197
Alignment:
240 agtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttgattatagaat 309  Q
    |||| |||||||| |||||| | | |||||| || |||||||||| |||||||||||||| || ||||||    
33019266 agtataattgattctgcctctagaattgattatatttgaagctagaatttgtagcttttggttttagaat 33019197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 300
Target Start/End: Original strand, 37561681 - 37561742
Alignment:
240 agtagaattgattttgcctcaatagttgattct-acttgaagctaggatttgtagcttttga 300  Q
    |||||| ||||||||||||| ||| |||||||| ||||||| ||| |||||||| |||||||    
37561681 agtagatttgattttgcctctataattgattctaacttgaaactacgatttgtaccttttga 37561742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 302
Target Start/End: Original strand, 42982544 - 42982581
Alignment:
265 ttgattctacttgaagctaggatttgtagcttttgatt 302  Q
    |||||||||||||||||||| | |||||||||||||||    
42982544 ttgattctacttgaagctagaaattgtagcttttgatt 42982581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 219 - 300
Target Start/End: Complemental strand, 23724 - 23643
Alignment:
219 tgacatgtttagttgctttccagtagaattgattttgcctcaatagttgattctacttgaagctaggatttgtagcttttga 300  Q
    |||||||||| |||||  || | | |||||||||||| ||| |||  | ||||||  |||||||||||||||||||||||||    
23724 tgacatgtttggttgccctcgaatggaattgattttgtctccataaataattctaactgaagctaggatttgtagcttttga 23643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0361 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0361
Description:

Target: scaffold0361; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Complemental strand, 14223 - 14179
Alignment:
240 agtagaattgattttgcctcaatagttgattctacttgaagctag 284  Q
    |||||||||||||||| | ||| | ||||||||||||||||||||    
14223 agtagaattgattttgtcacaagaattgattctacttgaagctag 14179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106219 times since January 2019
Visitors: 1320