View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-61 (Length: 623)

Name: J5-61
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-61
J5-61
[»] chr5 (2 HSPs)
chr5 (110-623)||(11631796-11632309)
chr5 (1-113)||(11631688-11631800)
[»] chr1 (5 HSPs)
chr1 (124-306)||(3814018-3814202)
chr1 (124-307)||(3811185-3811370)
chr1 (220-306)||(32703524-32703609)
chr1 (109-159)||(32703640-32703689)
chr1 (401-441)||(34946489-34946529)
[»] chr2 (2 HSPs)
chr2 (188-307)||(43141582-43141701)
chr2 (110-159)||(43141709-43141758)
[»] chr4 (5 HSPs)
chr4 (188-306)||(39398115-39398233)
chr4 (188-306)||(39400003-39400121)
chr4 (110-159)||(39398241-39398290)
chr4 (110-159)||(39400129-39400178)
chr4 (193-307)||(23430245-23430357)
[»] chr3 (5 HSPs)
chr3 (188-306)||(41406695-41406813)
chr3 (188-306)||(41408185-41408303)
chr3 (110-159)||(41406821-41406870)
chr3 (110-159)||(41408311-41408360)
chr3 (386-443)||(25739182-25739239)
[»] scaffold0048 (2 HSPs)
scaffold0048 (173-306)||(79485-79617)
scaffold0048 (174-262)||(80886-80973)


Alignment Details
Target: chr5 (Bit Score: 447; Significance: 0; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 447; E-Value: 0
Query Start/End: Original strand, 110 - 623
Target Start/End: Complemental strand, 11632309 - 11631796
Alignment:
110 aattgcttagagtgaaattacataggctagtgtttatatatagataaacagttgacnnnnnnnttagtttaaatctgccaaaataactctgtaataaaac 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||    
11632309 aattgcttagagtgaaattacataggctagtgtttatatatagataaacagttgacaaaaaaattagtttaaatctgccaaaataactctgtaataaaac 11632210  T
210 tattaatgatagaattaactctaataaaaaacttattaacttgctaggaaaaatcagttgacttctaactctatagctgtgagttaatctcctaacaact 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11632209 tattaatgatagaattaactctaataaaaaacttattaacttgctaggaaaaatcagttgacttctaactctatagctgtgagttaatctcctaacaact 11632110  T
310 tgacttgatctctttcacatcttgtctttgagatttgtaagactcaatgtattagtcttcgcaagctgcgcgccatccatttgggtcttgtaagactcga 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11632109 tgacttgatctctttcacatcttgtctttgagatttgtaagactcaatgtattagtcttcgcaagctgcgcgccatccatttgggtcttgtaagactcga 11632010  T
410 gatattactctccgcaagttgcgtgcggaggatatcggaattacgccaaaaataaaacaaaacatgttcaaaaatatactttcagacatattccatctgc 509  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11632009 gatattactctccgcaagttgcgtgcggaggatatcggaattacgccaaaaataaaacaaaacatgttcaaaaatatactttcagacatattccatctgc 11631910  T
510 aagcctacttgaaaagaagagtaattttgtcnnnnnnnnnnnnnngagaattgaggtatttatgaacactggggttgggggtgggaaacaaagcttccat 609  Q
    |||||||||||||||||||||||||||||||              ||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
11631909 aagcctacttgaaaagaagagtaattttgtcaaaaaaagaaaaaagagaattgaggtatttatgaacattggggttgggggtgggaaacaaagcttccat 11631810  T
610 aggataatgggaac 623  Q
    ||||||||||||||    
11631809 aggataatgggaac 11631796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 113; E-Value: 7e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 11631800 - 11631688
Alignment:
1 ggaacgacattgggggttggatcaatcaatcaattttctaataatagcttttcaatttcgataaaattaaaaaatatagttagtttccgaatttaatttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11631800 ggaacgacattgggggttggatcaatcaatcaattttctaataatagcttttcaatttcgataaaattaaaaaatatagttagtttccgaatttaatttc 11631701  T
101 ttgtttgagaatt 113  Q
    |||||||||||||    
11631700 ttgtttgagaatt 11631688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 137; Significance: 3e-71; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 137; E-Value: 3e-71
Query Start/End: Original strand, 124 - 306
Target Start/End: Complemental strand, 3814202 - 3814018
Alignment:
124 aaattacataggctagtgtttatatatagataaaca--gttgacnnnnnnnttagtttaaatctgccaaaataactctgtaataaaactattaatgatag 221  Q
    ||||||||||||||||||||||||||||||||||||  ||||||        ||||||||||||||||||||||||||||||||||||||||||||| ||    
3814202 aaattacataggctagtgtttatatatagataaacacagttgacaaaaaaactagtttaaatctgccaaaataactctgtaataaaactattaatgacag 3814103  T
222 aattaactctaataaaaaacttattaacttgctaggaaaaatcagttgacttctaactctatagctgtgagttaatctcctaaca 306  Q
    ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||    
3814102 aattaactctaataaaaaacttattaacttgctagtaaaaaccagttgacttctaactctatagctgtgagttaatctcctaaca 3814018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 124 - 307
Target Start/End: Complemental strand, 3811370 - 3811185
Alignment:
124 aaattacataggctagtgtttatatatagataaaca--gttgacnnnnnnnttagtttaaatctgccaaaataactctgtaataaaactattaatgatag 221  Q
    |||||||||||||||||| ||||||||||| |||||  ||||||        |||||||||||||||||||||||||||| |||||||||||||||| ||    
3811370 aaattacataggctagtggttatatatagaaaaacacagttgacaaaaaaactagtttaaatctgccaaaataactctgttataaaactattaatgacag 3811271  T
222 aattaactctaataaaaaacttattaacttgctaggaaaaatcagttgacttctaactctatagctgtgagttaatctcctaacaa 307  Q
    ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
3811270 aattaactctaataaaaaacttattaacttgctagtaaaaaccagttgacttctaactctatagctgtgagttaatctcctaacaa 3811185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 220 - 306
Target Start/End: Complemental strand, 32703609 - 32703524
Alignment:
220 agaattaactctaataaaaaacttattaacttgctaggaaaaatcagttgacttctaactctatagctgtgagttaatctcctaaca 306  Q
    ||||||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||||||    
32703609 agaattaactctaataaaaaact-attaacttgctagtaaaaaccagttgacttctaactgtatagctgtgagttaatctcctaaca 32703524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 109 - 159
Target Start/End: Complemental strand, 32703689 - 32703640
Alignment:
109 gaattgcttagagtgaaattacataggctagtgtttatatatagataaaca 159  Q
    ||||||||| || |||||||||||||||| ||||||||||| |||||||||    
32703689 gaattgcttggaatgaaattacataggctggtgtttatata-agataaaca 32703640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 401 - 441
Target Start/End: Original strand, 34946489 - 34946529
Alignment:
401 aagactcgagatattactctccgcaagttgcgtgcggagga 441  Q
    ||||||||||| |||| ||||||||||||||| ||||||||    
34946489 aagactcgagaaattagtctccgcaagttgcgagcggagga 34946529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 108; Significance: 6e-54; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 6e-54
Query Start/End: Original strand, 188 - 307
Target Start/End: Complemental strand, 43141701 - 43141582
Alignment:
188 caaaataactctgtaataaaactattaatgatagaattaactctaataaaaaacttattaacttgctaggaaaaatcagttgacttctaactctatagct 287  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||    
43141701 caaaataactctgtaataaaactattaatgacagaattaactctaataaaaaacttattaacttgctagtaaaaaccagttgacttctaactctatagct 43141602  T
288 gtgagttaatctcctaacaa 307  Q
    ||||||||||||||||||||    
43141601 gtgagttaatctcctaacaa 43141582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 110 - 159
Target Start/End: Complemental strand, 43141758 - 43141709
Alignment:
110 aattgcttagagtgaaattacataggctagtgtttatatatagataaaca 159  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||    
43141758 aattgcttagagttaaattacataggctagtgtttatatatagataaaca 43141709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 107; Significance: 2e-53; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 188 - 306
Target Start/End: Complemental strand, 39398233 - 39398115
Alignment:
188 caaaataactctgtaataaaactattaatgatagaattaactctaataaaaaacttattaacttgctaggaaaaatcagttgacttctaactctatagct 287  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||    
39398233 caaaataactctgtaataaaactattaatgacagaattaactctaataaaaaacttattaacttgctagtaaaaaccagttgacttctaactctatagct 39398134  T
288 gtgagttaatctcctaaca 306  Q
    |||||||||||||||||||    
39398133 gtgagttaatctcctaaca 39398115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 188 - 306
Target Start/End: Complemental strand, 39400121 - 39400003
Alignment:
188 caaaataactctgtaataaaactattaatgatagaattaactctaataaaaaacttattaacttgctaggaaaaatcagttgacttctaactctatagct 287  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||    
39400121 caaaataactctgtaataaaactattaatgacagaattaactctaataaaaaacttattaacttgctagtaaaaaccagttgacttctaactctatagct 39400022  T
288 gtgagttaatctcctaaca 306  Q
    |||||||||||||||||||    
39400021 gtgagttaatctcctaaca 39400003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 110 - 159
Target Start/End: Complemental strand, 39398290 - 39398241
Alignment:
110 aattgcttagagtgaaattacataggctagtgtttatatatagataaaca 159  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||    
39398290 aattgcttagagttaaattacataggctagtgtttatatatagataaaca 39398241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 110 - 159
Target Start/End: Complemental strand, 39400178 - 39400129
Alignment:
110 aattgcttagagtgaaattacataggctagtgtttatatatagataaaca 159  Q
    ||||||||||||| |||||||||||||||||||||||||| | |||||||    
39400178 aattgcttagagttaaattacataggctagtgtttatatacatataaaca 39400129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 193 - 307
Target Start/End: Original strand, 23430245 - 23430357
Alignment:
193 taactctgtaataaaactattaatgatagaattaactctaataaaaaacttattaacttgctaggaaaaa-tcagttgacttctaactctatagctgtga 291  Q
    |||||||||||||||||||||||||  | |||  |||| ||||||||   |||||||||||||  ||||| | ||||||| ||||| | ||||| |||||    
23430245 taactctgtaataaaactattaatggca-aatctactcgaataaaaac--tattaacttgctaataaaaactaagttgacctctaattttataggtgtga 23430341  T
292 gttaatctcctaacaa 307  Q
    ||||||||||||||||    
23430342 gttaatctcctaacaa 23430357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 99; Significance: 1e-48; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 188 - 306
Target Start/End: Complemental strand, 41406813 - 41406695
Alignment:
188 caaaataactctgtaataaaactattaatgatagaattaactctaataaaaaacttattaacttgctaggaaaaatcagttgacttctaactctatagct 287  Q
    |||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||    
41406813 caaaataattctgtaataaaattattaatgacagaattaactctaataaaaaacttattaacttgctagtaaaaaccagttgacttctaactctatagct 41406714  T
288 gtgagttaatctcctaaca 306  Q
    |||||||||||||||||||    
41406713 gtgagttaatctcctaaca 41406695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 188 - 306
Target Start/End: Complemental strand, 41408303 - 41408185
Alignment:
188 caaaataactctgtaataaaactattaatgatagaattaactctaataaaaaacttattaacttgctaggaaaaatcagttgacttctaactctatagct 287  Q
    ||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||    
41408303 caaaataactccgtagtaaaactattaatgacagaattaactctaataaaaaacttattaacttgctagtaaaaaccagttgacttctaactctatagct 41408204  T
288 gtgagttaatctcctaaca 306  Q
    |||||||||||||||||||    
41408203 gtgagttaatctcctaaca 41408185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 110 - 159
Target Start/End: Complemental strand, 41406870 - 41406821
Alignment:
110 aattgcttagagtgaaattacataggctagtgtttatatatagataaaca 159  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||    
41406870 aattgcttagagttaaattacataggctagtgtttatatatagataaaca 41406821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 110 - 159
Target Start/End: Complemental strand, 41408360 - 41408311
Alignment:
110 aattgcttagagtgaaattacataggctagtgtttatatatagataaaca 159  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||    
41408360 aattgcttagagttaaattacataggctagtgtttatatatagataaaca 41408311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 386 - 443
Target Start/End: Original strand, 25739182 - 25739239
Alignment:
386 ccatttgggtcttgtaagactcgagatattactctccgcaagttgcgtgcggaggata 443  Q
    |||||||||||   |||||||||| | |||| ||||||||||||||||||||||||||    
25739182 ccatttgggtcccataagactcgataaattagtctccgcaagttgcgtgcggaggata 25739239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0048 (Bit Score: 98; Significance: 6e-48; HSPs: 2)
Name: scaffold0048
Description:

Target: scaffold0048; HSP #1
Raw Score: 98; E-Value: 6e-48
Query Start/End: Original strand, 173 - 306
Target Start/End: Complemental strand, 79617 - 79485
Alignment:
173 ttagtttaaatctgccaaaataactctgtaataaaactattaatgatagaattaactctaataaaaaacttattaacttgctaggaaaaatcagttgact 272  Q
    |||||| ||||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||||| |||||||||||||||    
79617 ttagttcaaatctgtcaaaataactctgtaataaaactattaatgacataattaactctaataaaaaac-tattaacttgctagtaaaaatcagttgact 79519  T
273 tctaactctatagctgtgagttaatctcctaaca 306  Q
    ||||||| ||||| ||||||||||||||||||||    
79518 tctaactgtatagttgtgagttaatctcctaaca 79485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0048; HSP #2
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 174 - 262
Target Start/End: Complemental strand, 80973 - 80886
Alignment:
174 tagtttaaatctgccaaaataactctgtaataaaactattaatgatagaattaactctaataaaaaacttattaacttgctaggaaaaa 262  Q
    ||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||||| |||||    
80973 tagttcaaatctgccaaaataactctgtaataaaactattaatgacataattaactctaataaaaaac-tattaacttgctagtaaaaa 80886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110572 times since January 2019
Visitors: 1335