View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-63 (Length: 409)

Name: J5-63
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-63
J5-63
[»] chr7 (4 HSPs)
chr7 (1-361)||(34119002-34119362)
chr7 (243-331)||(35914421-35914509)
chr7 (356-409)||(34118953-34119006)
chr7 (122-166)||(35914930-35914974)


Alignment Details
Target: chr7 (Bit Score: 319; Significance: 1e-180; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 361
Target Start/End: Original strand, 34119002 - 34119362
Alignment:
1 attccaattccaaataggggccatatagcgcaatttagattagcatgggcataaactatctttttagtattggtttccatttttctgaaatatcatgatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34119002 attccaattccaaataggggccatatagcgcaatttagattagcatgggcataaactatctttttagtattggtttccatttttctgaaatatcatgatt 34119101  T
101 tgnnnnnnnatttacttaggattaggattatatattagtataaaaaatgttattactctgtcttttcattttactccttcnnnnnnntctaaatctagaa 200  Q
    ||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||    
34119102 tgtttttttatttacttaggattaggattatatattagtataaaaaatgttattactctgtcttttcattttactccttcaaaaaaatctaaatctagaa 34119201  T
201 tttaacatgtgttatatgcaaagtggagcagcaccactctgtatgcagcaagcgatattcctattggtgtagatattagaaatgcattttcagaggatta 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34119202 tttaacatgtgttatatgcaaagtggagcagcaccactctgtatgcagcaagcgatattcctattggtgtagatattagaaatgcattttcagaggatta 34119301  T
301 gccaccttgactctagtttttgctggtaaataagcaacacattcaactgtacattcaattg 361  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34119302 gccaccttgactctagtttttgctggtaaataagcaacacattcaactgtacattcaattg 34119362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 243 - 331
Target Start/End: Complemental strand, 35914509 - 35914421
Alignment:
243 atgcagcaagcgatattcctattggtgtagatattagaaatgcattttcagaggattagccaccttgactctagtttttgctggtaaat 331  Q
    |||| |||||| |||||||||| ||||||| |||||||||||||||||||||||||||  |||||||||||||||| |||| |||||||    
35914509 atgctgcaagcaatattcctataggtgtagctattagaaatgcattttcagaggattactcaccttgactctagttcttgccggtaaat 35914421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 356 - 409
Target Start/End: Original strand, 34118953 - 34119006
Alignment:
356 caattgcaagcttctacgtgtcctttgcgtttgtggccatttagacacaattcc 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34118953 caattgcaagcttctacgtgtcctttgcgtttgtggccatttagacacaattcc 34119006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 166
Target Start/End: Complemental strand, 35914974 - 35914930
Alignment:
122 ttaggattatatattagtataaaaaatgttattactctgtctttt 166  Q
    |||||||||||||||||||||||||| |||| ||||| |||||||    
35914974 ttaggattatatattagtataaaaaaggttagtactccgtctttt 35914930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110403 times since January 2019
Visitors: 1335