View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-64 (Length: 456)

Name: J5-64
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-64
J5-64
[»] chr2 (2 HSPs)
chr2 (59-456)||(43055048-43055445)
chr2 (1-65)||(43054988-43055052)


Alignment Details
Target: chr2 (Bit Score: 340; Significance: 0; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 59 - 456
Target Start/End: Complemental strand, 43055445 - 43055048
Alignment:
59 tcaattgtagtgggttctatttagtgttttttcttcctaatattnnnnnnnnnnnnnnnnnntcaagtgttaacaacaaacatatatgttaggtctagcg 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||                  ||||||||||||||||||||||||||||||||||||||    
43055445 tcaattgtagtgggttctatttagtgttttttcttcctaatattaaaattaaaaaacaaaaatcaagtgttaacaacaaacatatatgttaggtctagcg 43055346  T
159 taagaggctagactctcacaatttgataaactaagatttaaatatcaatgaagagaggtgtccatatttaatgtcggacaatatctcgaatatgattaca 258  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43055345 taagaggctagactctcacaatttgataaactaagatttaaatatcaatgaagagaggtgtccatatttaatgtcggacaatatctcgaatatgattaca 43055246  T
259 tttagtcgagggaatttatgcaagaaaaaggtaatgaagtgttgactgcaaacgtttaaagttgtatctactggagaatattcgagagaaaatgtttgat 358  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43055245 tttagtcgagggaatttatgcaagaaaaaagtaatgaagtgttgactgcaaacgtttaaagttgtatctactggagaatattcgagagaaaatgtttgat 43055146  T
359 tgaccaagtagagcacggcaaaatgtgaattgtgtttaagaaacttgtgcttcaagcaaaaacttgttaatgactgacatagccgtgaagggttagac 456  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43055145 tgaccaagtagagcacggcaaaatgtgaattgtgtttaagaaacttgtgcttcaagcaaaaacttgttaatgactgacatagccgtgaagggttagac 43055048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 43055052 - 43054988
Alignment:
1 tagactgtgtgactaagttaataattccacaagttttcccaaactttctcccaacatttcaattg 65  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43055052 tagactgtgtgactaagttaataattccacaagttttcccaaactttctcccaacatttcaattg 43054988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175921 times since January 2019
Visitors: 1577