View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-65 (Length: 185)

Name: J5-65
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-65
J5-65
[»] chr8 (4 HSPs)
chr8 (82-185)||(39625131-39625234)
chr8 (82-185)||(39634681-39634784)
chr8 (1-88)||(39625048-39625135)
chr8 (1-88)||(39634598-39634685)


Alignment Details
Target: chr8 (Bit Score: 104; Significance: 4e-52; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 104; E-Value: 4e-52
Query Start/End: Original strand, 82 - 185
Target Start/End: Complemental strand, 39625234 - 39625131
Alignment:
82 tcaattgaccctttctttattcgctttcttcaagatcttcaaaagcgtgttcttctttctaataatattcaagtgcccatgcgggggagcgatgacgttg 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39625234 tcaattgaccctttctttattcgctttcttcaagatcttcaaaagcgtgttcttctttctaataatattcaagtgcccatgcgggggagcgatgacgttg 39625135  T
182 atag 185  Q
    ||||    
39625134 atag 39625131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 104; E-Value: 4e-52
Query Start/End: Original strand, 82 - 185
Target Start/End: Complemental strand, 39634784 - 39634681
Alignment:
82 tcaattgaccctttctttattcgctttcttcaagatcttcaaaagcgtgttcttctttctaataatattcaagtgcccatgcgggggagcgatgacgttg 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39634784 tcaattgaccctttctttattcgctttcttcaagatcttcaaaagcgtgttcttctttctaataatattcaagtgcccatgcgggggagcgatgacgttg 39634685  T
182 atag 185  Q
    ||||    
39634684 atag 39634681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 39625135 - 39625048
Alignment:
1 gatagtcattgtgaagtcaaacctttgttggaggagttgttgccatcggtgcagagtcctactcattttccaaataatgaatcaattg 88  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39625135 gatagtcattgtgaagtcaaacctttgttggaggagttgttgccatcggtgcagagtcctactcattttccaaataatgaatcaattg 39625048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 39634685 - 39634598
Alignment:
1 gatagtcattgtgaagtcaaacctttgttggaggagttgttgccatcggtgcagagtcctactcattttccaaataatgaatcaattg 88  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39634685 gatagtcattgtgaagtcaaacctttgttggaggagttgttgccatcggtgcagagtcctactcattttccaaataatgaatcaattg 39634598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361738 times since January 2019
Visitors: 488