View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-1 (Length: 341)

Name: J5-7-1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-1
J5-7-1
[»] chr4 (4 HSPs)
chr4 (186-341)||(47277329-47277484)
chr4 (1-128)||(47277206-47277333)
chr4 (186-339)||(47264941-47265093)
chr4 (5-76)||(47264872-47264939)


Alignment Details
Target: chr4 (Bit Score: 132; Significance: 2e-68; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 186 - 341
Target Start/End: Complemental strand, 47277484 - 47277329
Alignment:
186 ctaccttattgactgtgttgtttgtacncaannangcttaattgtttatacatgatcccttcgagaataattgtttgcagtttataccacgataagcact 285  Q
    |||||||||||||||||||||||||||   |  | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47277484 ctaccttattgactgtgttgtttgtactagattatgtttaattgtttatacatgatcccttcgagaataattgtttgcagtttataccacgataagcact 47277385  T
286 ttgactacactccaacttttttggccaagtccaaaaccatttatttgcaacttact 341  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47277384 ttgactacactccaacttttttggccaagtccaaaaccatttatttgcaacttact 47277329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 47277333 - 47277206
Alignment:
1 ttacttaccacnaataattagtatatgtattgttgttgttagtcaagcaaatttggtgtttacccaactaattgttcctatatgtgattagttgtttgtt 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||    
47277333 ttacttaccacaaataattagtatatgtattgttgttgttagtcaagcaaatttggtgtttagacaactaattgttcctatatgtgattagttgtttgtt 47277234  T
101 tgtttgtcatttgctaaactcaaaagac 128  Q
    ||||||||||||||||||||||||||||    
47277233 tgtttgtcatttgctaaactcaaaagac 47277206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 186 - 339
Target Start/End: Complemental strand, 47265093 - 47264941
Alignment:
186 ctaccttattgactgtgttgtttgtacncaannangcttaattgtttatacatgatcccttcgagaataattgtttgcagtttataccacga---taagc 282  Q
    ||||||| |||||||||||||||||||   |  | | ||  ||||||||||||||||||||| ||||||| ||||||||||||||||||| |   ||| |    
47265093 ctaccttcttgactgtgttgtttgtactagattatgttt--ttgtttatacatgatcccttcaagaataactgtttgcagtttataccaccacgttaaac 47264996  T
283 actttgactacactccaacttttttggccaagtccaaaaccatttatttgcaactta 339  Q
    |||| ||||| |||||||||||||||||||||||||||||||||  |||||||||||    
47264995 acttggactatactccaacttttttggccaagtccaaaaccatt--tttgcaactta 47264941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 5 - 76
Target Start/End: Complemental strand, 47264939 - 47264872
Alignment:
5 ttaccacnaataattagtatatgtattgttgttgttagtcaagcaaatttggtgtttacccaactaattgtt 76  Q
    ||||||| |||||||||||||||||||||||||    |||| |||||||||||||||| |||||||||||||    
47264939 ttaccacaaataattagtatatgtattgttgtt----gtcatgcaaatttggtgtttagccaactaattgtt 47264872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 305839 times since January 2019
Visitors: 439