View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-1-13 (Length: 253)

Name: J5-7-1-13
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-1-13
J5-7-1-13
[»] chr2 (2 HSPs)
chr2 (116-253)||(1157544-1157681)
chr2 (1-121)||(1157428-1157548)


Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 116 - 253
Target Start/End: Complemental strand, 1157681 - 1157544
Alignment:
116 attaattgaagaaatgagagttgagagagaaatcaagtgaaaattatggacattgatagtgtcaacaagaattatatgcactattcttcttcattaaaca 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
1157681 attaattgaagaaatgagagttgagagagaaatcaagtgaaaattaaggacattgatagtgtcaacaagaattatatgcactattcttcttcattaaaca 1157582  T
216 ctcagtccatcgaatccacactgcttgtaagtcagaga 253  Q
    ||||||||||||||||||||||||||||||||||||||    
1157581 ctcagtccatcgaatccacactgcttgtaagtcagaga 1157544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 1157548 - 1157428
Alignment:
1 agagattgctttcttggactaatcactatagcacaatccaccgagacctgtgaagtttagttcatgatcaattgttaatctattggtaatgcaatgctta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1157548 agagattgctttcttggactaatcactatagcacaatccaccgagacctgtgaagtttagttcatgatcaattgttaatctattggtaatgcaatgctta 1157449  T
101 attaaaacaatactgattaat 121  Q
    |||||||||||||||||||||    
1157448 attaaaacaatactgattaat 1157428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105916 times since January 2019
Visitors: 1319