View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-14 (Length: 242)

Name: J5-7-14
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-14
J5-7-14
[»] chr3 (2 HSPs)
chr3 (73-242)||(38619260-38619429)
chr3 (1-78)||(38619187-38619264)


Alignment Details
Target: chr3 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 73 - 242
Target Start/End: Complemental strand, 38619429 - 38619260
Alignment:
73 attaataactacntatttgcatgtgattaacccgatgtgacatggatgtaaacgaatgcccatgtatatcattactgttacaataataagcacttattga 172  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38619429 attaataactacatatttgcatgtgattaacccgatgtgacatggatgtaaacgaatgcccatgtatatcattactgttacaataataagcacttattga 38619330  T
173 ttttgccttacaaagaagctaaaatgtaacaagctgacgaagcggaagataatacacttttgcaaacaaa 242  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
38619329 ttttgccttacaaagaagctaaaatgtaacaagctgacgaagtggaagataatacacttttgcaaacaaa 38619260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 38619264 - 38619187
Alignment:
1 acaaaatggttaagatttttccactttataatatcattcagcagtaccaaagataagaatgggaaataagacattaat 78  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38619264 acaaaatggttaagatttttccactttataatatcattcagcagtaccaaagataagaatgggaaataagacattaat 38619187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 362141 times since January 2019
Visitors: 488