View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-16 (Length: 302)

Name: J5-7-16
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-16
J5-7-16
[»] chr5 (2 HSPs)
chr5 (1-266)||(41738311-41738576)
chr5 (260-302)||(41738572-41738614)


Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 41738576 - 41738311
Alignment:
1 gctacactacagtctaagccactgattaccatttatgaagttaatgtccaagaaaggctttgcttctccatagctgaattgttttgaccaaggcaccctc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41738576 gctacactacagtctaagccactgattaccatttatgaagttaatgtccaagaaaggctttgcttctccatagctgaattgttttgaccaaggcaccctc 41738477  T
101 ttttttatatttgctcctattccatggcacttaaattcaccaaacactgcagtcctgaaacaccaaatgcttataaaatgtcaaatcaaatgtagaacaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41738476 ttttttatatttgctcctattccatggcacttaaattcaccaaacactgcagtcctgaaacaccaaatgcttataaaatgtcaaatcaaatgtagaacaa 41738377  T
201 actatgaagcattgacgcagacaccgatactgctcacgacactaacatgtcgtcaccagaattaat 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41738376 actatgaagcattgacgcagacaccgatactgctcacgacactaacatgtcgtcaccagaattaat 41738311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 260 - 302
Target Start/End: Complemental strand, 41738614 - 41738572
Alignment:
260 aattaatgaagtaatatatgtcatttgattggtgcattgctac 302  Q
    |||||||||||||||||||||||||||||||||||||||||||    
41738614 aattaatgaagtaatatatgtcatttgattggtgcattgctac 41738572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 202552 times since January 2019
Visitors: 1517