View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-2 (Length: 339)

Name: J5-7-2
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-2
J5-7-2
[»] chr8 (2 HSPs)
chr8 (70-339)||(11024903-11025172)
chr8 (1-76)||(11024832-11024907)
[»] chr7 (1 HSPs)
chr7 (258-325)||(29810838-29810905)


Alignment Details
Target: chr8 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 70 - 339
Target Start/End: Complemental strand, 11025172 - 11024903
Alignment:
70 attaattaaacagatatagtgcaacccaaaattatcctcaatatcatcataaacattaaagttgttgaaagagtagaaaataagaaaaccatttgatatg 169  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11025172 attaattaaacagatatagtgcaacccaaaattatcctcaatatcatcataaacattaaagttgttgaaagagtagaaaataagaaaaccatttgatatg 11025073  T
170 taagaaaatatatgcataataacattatgaactgtgttatagttacagaagtcccatccttacattgctgtgtttatttgaccatttagatccatcgacg 269  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11025072 taagaaaatatatgcataataacattatgaactgtgttatagttacagaagtcccatccttacattgctgtgtttatttgaccatttagatccatcgacg 11024973  T
270 acaaacaacttccttgctggaaacttgagggaggcagcgagttcctcaattttctctgagttgaccttca 339  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11024972 acaaacaacttccttgctggaaacttgagggaggcagcgagttcctcaattttctctgagttgaccttca 11024903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 11024907 - 11024832
Alignment:
1 cttcaggcagctggtaaccagatcattgtgaggggaatgatattataaacaaataaagtacatgcttacattaatt 76  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11024907 cttcaggcagctggtaaccagatcattgtgaggggaatgatattataaacaaataaagtacatgcttacattaatt 11024832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 258 - 325
Target Start/End: Original strand, 29810838 - 29810905
Alignment:
258 gatccatcgacgacaaacaacttccttgctggaaacttgagggaggcagcgagttcctcaattttctc 325  Q
    |||||||| || |||||||||||| ||  |||||| |||||||||| ||| |||| ||||||||||||    
29810838 gatccatcaacaacaaacaacttctttaatggaaaattgagggaggaagcaagtttctcaattttctc 29810905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 315693 times since January 2019
Visitors: 447