View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-20 (Length: 363)

Name: J5-7-20
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-20
J5-7-20
[»] chr1 (4 HSPs)
chr1 (46-168)||(26255855-26255977)
chr1 (255-345)||(26255705-26255795)
chr1 (163-198)||(26255613-26255648)
chr1 (1-30)||(26255809-26255838)


Alignment Details
Target: chr1 (Bit Score: 123; Significance: 4e-63; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 46 - 168
Target Start/End: Original strand, 26255855 - 26255977
Alignment:
46 gagcaattagaacttttcttgcatcaatgtatatttgctaattatggggattcaatcgactggctgccaatttctgaaattactatttggtctacagtta 145  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26255855 gagcaattagaacttttcttgcatcaatgtatatttgctaattatggggattcaatcgactggctgccaatttctgaaattactatttggtctacagtta 26255954  T
146 tattcttttctcacgatattaat 168  Q
    |||||||||||||||||||||||    
26255955 tattcttttctcacgatattaat 26255977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 255 - 345
Target Start/End: Original strand, 26255705 - 26255795
Alignment:
255 gataaaatagtactactagtagttttcttaatcaaaagtactcatttttcttgcgagtaaaattttcaacaggttaatttcatgggggtgt 345  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26255705 gataaaatagtactactagtagttttcttaatcaaaagtactcatttttcttgcgagtaaaattttcaacaggttaatttcatgggggtgt 26255795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 198
Target Start/End: Original strand, 26255613 - 26255648
Alignment:
163 attaattatgcgtattttgaaatgcatatccatggc 198  Q
    ||||||||||||||||||||||||||||||||||||    
26255613 attaattatgcgtattttgaaatgcatatccatggc 26255648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 26255809 - 26255838
Alignment:
1 gctcctccgtttcaatcgactaattagaac 30  Q
    ||||||||||||||||||||||||||||||    
26255809 gctcctccgtttcaatcgactaattagaac 26255838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360138 times since January 2019
Visitors: 482