View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-21 (Length: 524)

Name: J5-7-21
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-21
J5-7-21
[»] chr3 (7 HSPs)
chr3 (1-382)||(5498720-5499101)
chr3 (377-524)||(5499097-5499244)
chr3 (402-512)||(1655085-1655196)
chr3 (405-512)||(2550674-2550782)
chr3 (405-512)||(13846500-13846608)
chr3 (402-512)||(7407233-7407344)
chr3 (402-477)||(7395662-7395738)
[»] chr4 (4 HSPs)
chr4 (257-382)||(24557788-24557914)
chr4 (405-512)||(43600775-43600883)
chr4 (278-312)||(24557920-24557954)
chr4 (398-483)||(1472999-1473085)
[»] chr7 (2 HSPs)
chr7 (402-512)||(19747734-19747845)
chr7 (402-512)||(4684882-4684993)
[»] chr2 (3 HSPs)
chr2 (301-382)||(27149921-27150002)
chr2 (402-512)||(31342211-31342322)
chr2 (75-125)||(27149580-27149630)
[»] chr1 (1 HSPs)
chr1 (398-501)||(12191049-12191153)
[»] chr5 (2 HSPs)
chr5 (402-512)||(7411822-7411933)
chr5 (402-512)||(5077293-5077404)
[»] chr8 (3 HSPs)
chr8 (402-512)||(28248559-28248670)
chr8 (405-512)||(45355596-45355704)
chr8 (402-512)||(25639317-25639428)
[»] chr6 (3 HSPs)
chr6 (402-512)||(15362225-15362336)
chr6 (402-512)||(16735314-16735425)
chr6 (289-369)||(23903982-23904065)
[»] scaffold0576 (1 HSPs)
scaffold0576 (402-512)||(7209-7320)


Alignment Details
Target: chr3 (Bit Score: 353; Significance: 0; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 1 - 382
Target Start/End: Complemental strand, 5499101 - 5498720
Alignment:
1 atttctaccttttgaagatcagaaaggtatggtgattgtatatatttactcnnnnnnnctaagaatggtatgcttaaatgattgtttcgttagattcctt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||    
5499101 atttctaccttttgaagatcagaaaggtatggtgattgtatatatttactctttttttctaagaatggtatgcttaaatgattgtttcgttagattcctt 5499002  T
101 taagttttaatcttgcatattttcaagttgtgagatgttgagcattgcttgaagttttcatattcagttgggtgtcgtttttgttaggtgatttatgatt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5499001 taagttttaatcttgcatattttcaagttgtgagatgttgagcattgcttgaagttttcatattcagttgggtgtcgtttttgttaggtgatttatgatt 5498902  T
201 cggtggatttttgtagccgcatcagttatgtgcttaataaacttgctcactgtcgttttttatcgtccttttgtgacatatccctatcatttggtgaata 300  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
5498901 cagtggatttttgtagccgcatcagttatgtgcttaataaacttgctcactgtcgttttttatcttccttttgtgacatatccctatcatttggtgaata 5498802  T
301 tgatgaactaattccatatgtttacttaaaagattgtgtcacagtttttagaaaactgtagaatataactaatcaaattaat 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5498801 tgatgaactaattccatatgtttacttaaaagattgtgtcacagtttttagaaaactgtagaatataactaatcaaattaat 5498720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 148; E-Value: 7e-78
Query Start/End: Original strand, 377 - 524
Target Start/End: Complemental strand, 5499244 - 5499097
Alignment:
377 attaatgccacaatagaaaggagatatgtctgcaatcttgcaggcagagcattatgaagatgcttgcggtaagcaacgccgcaatacaaaggagattaaa 476  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5499244 attaatgccacaatagaaaggagatatgtctgcaatcttgcaggcagagcattatgaagatgcttgcggtaagcaacgccgcaatacaaaggagattaaa 5499145  T
477 gaaaaggattgcatttctattgtgctgcttgatgacattattgatttc 524  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
5499144 gaaaaggattgcatttctattgtgctgcttgatgacattattgatttc 5499097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 402 - 512
Target Start/End: Complemental strand, 1655196 - 1655085
Alignment:
402 atgtctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtg 500  Q
    ||||||||||||||||||||||| ||||||||||||| |||||| ||||||||| | ||| ||||||||||||||||| |||| ||||||||||  ||||    
1655196 atgtctgcaatcttgcaggcagaacattatgaagatgattgcggataagcaacgacacaagacaaaggagattaaagagaaggcttgcatttctcatgtg 1655097  T
501 ctgcttgatgac 512  Q
    | ||||||||||    
1655096 cagcttgatgac 1655085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 405 - 512
Target Start/End: Complemental strand, 2550782 - 2550674
Alignment:
405 tctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtgctg 503  Q
    |||||||||||||||||||| ||||||||||||| |||||| ||||||||| | ||| ||||||||||||||||| |||| ||||||||||  ||||| |    
2550782 tctgcaatcttgcaggcagaacattatgaagatgattgcggataagcaacggcacaagacaaaggagattaaagagaaggcttgcatttctcatgtgcag 2550683  T
504 cttgatgac 512  Q
    |||||||||    
2550682 cttgatgac 2550674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 405 - 512
Target Start/End: Complemental strand, 13846608 - 13846500
Alignment:
405 tctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtgctg 503  Q
    |||||||||||||||||||| ||||||||||||| |||||| ||||||||| | ||| ||||||||||||||||| |||| ||||||||||  ||||| |    
13846608 tctgcaatcttgcaggcagaacattatgaagatgattgcggataagcaacggcacaagacaaaggagattaaagagaaggcttgcatttctcatgtgcag 13846509  T
504 cttgatgac 512  Q
    |||||||||    
13846508 cttgatgac 13846500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 402 - 512
Target Start/End: Original strand, 7407233 - 7407344
Alignment:
402 atgtctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtg 500  Q
    |||||||||||||||| |||||| ||||||||||||| |||||| ||||||||| | ||| ||||||||||||||||| |||| ||||||||||  ||||    
7407233 atgtctgcaatcttgctggcagaacattatgaagatgattgcggataagcaacggcacaagacaaaggagattaaagagaaggcttgcatttctcatgtg 7407332  T
501 ctgcttgatgac 512  Q
    | ||||||||||    
7407333 cagcttgatgac 7407344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 402 - 477
Target Start/End: Original strand, 7395662 - 7395738
Alignment:
402 atgtctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaag 477  Q
    |||||||||||||||| |||||| ||||||||||||| |||||| ||||||| | |  || ||||||||||||||||    
7395662 atgtctgcaatcttgctggcagaacattatgaagatgattgcggataagcaatggcataagacaaaggagattaaag 7395738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 91; Significance: 7e-44; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 257 - 382
Target Start/End: Original strand, 24557788 - 24557914
Alignment:
257 tttttatcgtccttttgt-gacatatccctatcatttggtgaatatgatgaactaattccatatgtttacttaaaagattgtgtcacagtttttagaaaa 355  Q
    |||| ||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
24557788 ttttgatcttccttttgttgatatatccctatcatttggtgaatatgatgaactaattccataagtttacttaaaagattgtgtcacagtttttagaaaa 24557887  T
356 ctgtagaatataactaatcaaattaat 382  Q
    || ||||||||||| |||||| |||||    
24557888 ctatagaatataaccaatcaagttaat 24557914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 405 - 512
Target Start/End: Complemental strand, 43600883 - 43600775
Alignment:
405 tctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtgctg 503  Q
    |||||||||||||||||||| ||||||||||||| |||||| ||||||||| | ||| ||||||||||||||||| |||| ||||||||||  ||||| |    
43600883 tctgcaatcttgcaggcagaacattatgaagatgattgcggataagcaacggcacaagacaaaggagattaaagagaaggcttgcatttctcatgtgcag 43600784  T
504 cttgatgac 512  Q
    |||||||||    
43600783 cttgatgac 43600775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 312
Target Start/End: Original strand, 24557920 - 24557954
Alignment:
278 atatccctatcatttggtgaatatgatgaactaat 312  Q
    |||||||||||||||||||||||||||||||||||    
24557920 atatccctatcatttggtgaatatgatgaactaat 24557954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 398 - 483
Target Start/End: Original strand, 1472999 - 1473085
Alignment:
398 agatatgtctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaagg 483  Q
    ||||||| ||| |||| |||||||||||| || ||||||||||||||| |||||| |||||  | ||  |||||||||||| |||||    
1472999 agatatggctggaatcctgcaggcagagctttgtgaagatgcttgcggataagcagcgccgtgagaccgaggagattaaagcaaagg 1473085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 76; Significance: 7e-35; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 402 - 512
Target Start/End: Complemental strand, 19747845 - 19747734
Alignment:
402 atgtctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtg 500  Q
    ||||||||||||||||||||| | |||||||||||||||||||| ||||||||||| ||| ||||||||||||||||| |||||||||||||||| ||||    
19747845 atgtctgcaatcttgcaggcaaaacattatgaagatgcttgcggataagcaacgccacaagacaaaggagattaaagagaaggattgcatttctaatgtg 19747746  T
501 ctgcttgatgac 512  Q
    | ||||||||||    
19747745 cagcttgatgac 19747734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 402 - 512
Target Start/End: Original strand, 4684882 - 4684993
Alignment:
402 atgtctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtg 500  Q
    |||||||||||||||| |||||| ||||||||||||| |||||| ||||||||| | ||| ||||||||||||||||| |||| ||||||||||  ||||    
4684882 atgtctgcaatcttgctggcagaacattatgaagatgattgcggataagcaacgacacaagacaaaggagattaaagagaaggcttgcatttctcatgtg 4684981  T
501 ctgcttgatgac 512  Q
    | ||||||||||    
4684982 cagcttgatgac 4684993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 70; Significance: 2e-31; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 301 - 382
Target Start/End: Original strand, 27149921 - 27150002
Alignment:
301 tgatgaactaattccatatgtttacttaaaagattgtgtcacagtttttagaaaactgtagaatataactaatcaaattaat 382  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||    
27149921 tgatgaactaatttcatatgtttacttaaaagattgtgtcacagtttttagaaaactgtagaatataaccaatcaagttaat 27150002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 402 - 512
Target Start/End: Original strand, 31342211 - 31342322
Alignment:
402 atgtctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtg 500  Q
    |||||||||||||||| |||||| ||||||||||||| |||||| ||||||||| | ||| ||||||||||||||||| |||| ||||||||||  ||||    
31342211 atgtctgcaatcttgctggcagaacattatgaagatgattgcggataagcaacggcacaagacaaaggagattaaagagaaggcttgcatttctcatgtg 31342310  T
501 ctgcttgatgac 512  Q
    | ||||||||||    
31342311 cagcttgatgac 31342322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 75 - 125
Target Start/End: Original strand, 27149580 - 27149630
Alignment:
75 taaatgattgtttcgttagattcctttaagttttaatcttgcatattttca 125  Q
    |||||||||||||  |||||||||||||||||||| ||| |||||||||||    
27149580 taaatgattgttttattagattcctttaagttttagtctagcatattttca 27149630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 69; Significance: 1e-30; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 398 - 501
Target Start/End: Complemental strand, 12191153 - 12191049
Alignment:
398 agatatgtctgcaatcttgcaggcagagcattatgaagatgcttgcg-gtaagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctat 496  Q
    |||||||||||||||||||||||||||||||||||||||||||||||  |||| |||||| ||| |||| ||||||||||||||||| ||||| ||||||    
12191153 agatatgtctgcaatcttgcaggcagagcattatgaagatgcttgcgtataagtaacgccacaacacaacggagattaaagaaaaggcttgcacttctat 12191054  T
497 tgtgc 501  Q
    |||||    
12191053 tgtgc 12191049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 68; Significance: 4e-30; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 402 - 512
Target Start/End: Complemental strand, 7411933 - 7411822
Alignment:
402 atgtctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtg 500  Q
    ||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||| ||| ||||||||||||||||| |||| ||||||||||  ||||    
7411933 atgtctgcaatcttgcaggcagaacattatgaagatgattgcggataagcaacgccacaagacaaaggagattaaagagaaggcttgcatttctcatgtg 7411834  T
501 ctgcttgatgac 512  Q
    | ||||||||||    
7411833 cagcttgatgac 7411822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 402 - 512
Target Start/End: Original strand, 5077293 - 5077404
Alignment:
402 atgtctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtg 500  Q
    ||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||| ||| ||||||||| ||||||| |||| ||||||||||  ||||    
5077293 atgtctgcaatcttgcaggcagaacattatgaagatgattgcggataagcaacgccacaagacaaaggaggttaaagagaaggcttgcatttctcctgtg 5077392  T
501 ctgcttgatgac 512  Q
    | ||||||||||    
5077393 cagcttgatgac 5077404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 64; Significance: 1e-27; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 402 - 512
Target Start/End: Original strand, 28248559 - 28248670
Alignment:
402 atgtctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtg 500  Q
    ||||||||||||||||||||||| ||||||||||||| |||||| ||||||||| | ||| ||||||||||||||||| |||| ||||||||||  ||||    
28248559 atgtctgcaatcttgcaggcagaacattatgaagatgattgcggataagcaacgacacaagacaaaggagattaaagagaaggcttgcatttctcatgtg 28248658  T
501 ctgcttgatgac 512  Q
    | ||||||||||    
28248659 cagcttgatgac 28248670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 405 - 512
Target Start/End: Original strand, 45355596 - 45355704
Alignment:
405 tctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtgctg 503  Q
    |||||||||||||||||||| ||||||||||||| |||||| ||||||||| | ||| ||||||||||||||||| |||| ||||||||||  ||||| |    
45355596 tctgcaatcttgcaggcagaacattatgaagatgattgcggataagcaacggcacaagacaaaggagattaaagagaaggcttgcatttctcatgtgcag 45355695  T
504 cttgatgac 512  Q
    |||||||||    
45355696 cttgatgac 45355704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 402 - 512
Target Start/End: Complemental strand, 25639428 - 25639317
Alignment:
402 atgtctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtg 500  Q
    |||||||||||||||| |||||| ||||||||||||| |||||| ||||||||| | ||| ||||||||||||||||| |||| ||||||||||  ||||    
25639428 atgtctgcaatcttgctggcagaacattatgaagatgattgcggataagcaacggcacaagacaaaggagattaaagagaaggcttgcatttctcatgtg 25639329  T
501 ctgcttgatgac 512  Q
    | ||||||||||    
25639328 cagcttgatgac 25639317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 60; Significance: 2e-25; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 402 - 512
Target Start/End: Complemental strand, 15362336 - 15362225
Alignment:
402 atgtctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtg 500  Q
    |||||||||||||||| |||||| ||||||||||||| |||||| ||||||||| | ||| ||||||||||||||||| |||| ||||||||||  ||||    
15362336 atgtctgcaatcttgctggcagaacattatgaagatgattgcggataagcaacggcacaagacaaaggagattaaagagaaggcttgcatttctcatgtg 15362237  T
501 ctgcttgatgac 512  Q
    | ||||||||||    
15362236 cagcttgatgac 15362225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 402 - 512
Target Start/End: Complemental strand, 16735425 - 16735314
Alignment:
402 atgtctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtg 500  Q
    |||||||||||||||| |||||| ||||||||||||| |||||| ||||||||| | ||| ||||||||||||||||| |||| ||||||||||  ||||    
16735425 atgtctgcaatcttgctggcagaacattatgaagatgattgcggataagcaacggcacaagacaaaggagattaaagagaaggcttgcatttctcatgtg 16735326  T
501 ctgcttgatgac 512  Q
    | ||||||||||    
16735325 cagcttgatgac 16735314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 289 - 369
Target Start/End: Original strand, 23903982 - 23904065
Alignment:
289 atttggtgaatatgatgaactaattccatatgtttactta---aaagattgtgtcacagtttttagaaaactgtagaatataac 369  Q
    |||||| |||||| ||||||||||||||  |||||||||    ||||||| ||| |||||||||||||||||||| || |||||    
23903982 atttggcgaatataatgaactaattccacttgtttacttctagaaagattttgtaacagtttttagaaaactgtaaaagataac 23904065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0576 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: scaffold0576
Description:

Target: scaffold0576; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 402 - 512
Target Start/End: Complemental strand, 7320 - 7209
Alignment:
402 atgtctgcaatcttgcaggcagagcattatgaagatgcttgcgg-taagcaacgccgcaatacaaaggagattaaagaaaaggattgcatttctattgtg 500  Q
    |||||||||||||||| | | || ||||||||||||| |||||| ||||||||| | ||| ||||||||||||||||| |||| ||||||||||  ||||    
7320 atgtctgcaatcttgctgtcggaacattatgaagatgattgcggataagcaacggcacaagacaaaggagattaaagagaaggcttgcatttctcatgtg 7221  T
501 ctgcttgatgac 512  Q
    | ||||||||||    
7220 cagcttgatgac 7209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 201936 times since January 2019
Visitors: 1513