View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-22 (Length: 294)

Name: J5-7-22
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-22
J5-7-22
[»] chr1 (1 HSPs)
chr1 (34-294)||(24142381-24142641)
[»] chr2 (3 HSPs)
chr2 (178-258)||(20625647-20625727)
chr2 (202-244)||(16363037-16363079)
chr2 (38-138)||(17362898-17362998)
[»] scaffold0391 (1 HSPs)
scaffold0391 (176-282)||(604-711)
[»] chr4 (2 HSPs)
chr4 (43-138)||(21118225-21118320)
chr4 (44-99)||(18954443-18954498)
[»] chr6 (2 HSPs)
chr6 (202-258)||(1771900-1771956)
chr6 (51-269)||(9030942-9031165)
[»] chr7 (2 HSPs)
chr7 (197-240)||(42229583-42229626)
chr7 (53-87)||(20216363-20216397)


Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 34 - 294
Target Start/End: Original strand, 24142381 - 24142641
Alignment:
34 ttaatgggggatgcagtagacaagacacatcatcaagtgttattgtcatctccctaattggaagattgaagttagacacctcctcgttccatctcccaac 133  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24142381 ttaatgggggatgcagtagacaagacacatcatcaagtgttattgtcatctccctaattggaagattgaagttagacacctcctcgttccatctcccaac 24142480  T
134 aaaagtagataaaaaatcgtggtaaaggataggataactgactgtagccactgaagtccaccggctcacatggcatttttgaaccatcactcttgcatcc 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24142481 aaaagtagataaaaaatcgtggtaaaggataggataactgactgtagccactgaagtccaccggctcacatggcatttttgaaccatcactcttgcatcc 24142580  T
234 tatccaaatttagttcttgtatagcagtagcttttttccgttattcacattaagttgacac 294  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24142581 tatccaaatttagttcttgtatagcagtagcttttttccgttattcacattaagttgacac 24142641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 258
Target Start/End: Complemental strand, 20625727 - 20625647
Alignment:
178 tagccactgaagtccaccggctcacatggcatttttgaaccatcactcttgcatcctatccaaatttagttcttgtatagc 258  Q
    ||||||||||||||||  || ||||||||| | ||||||||||| ||||||||||||||||| || | |||||||||||||    
20625727 tagccactgaagtccattggatcacatggcctctttgaaccatcgctcttgcatcctatccacatctggttcttgtatagc 20625647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 202 - 244
Target Start/End: Complemental strand, 16363079 - 16363037
Alignment:
202 catggcatttttgaaccatcactcttgcatcctatccaaattt 244  Q
    |||||||| |||||||||||| |||||||| ||||||||||||    
16363079 catggcatctttgaaccatcattcttgcatgctatccaaattt 16363037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 38 - 138
Target Start/End: Original strand, 17362898 - 17362998
Alignment:
38 tgggggatgcagtagacaagacacatcatcaagtgttattgtcatctccctaattggaagattgaagttagacacctcctcgttccatctcccaacaaaa 137  Q
    |||| ||||||| ||||| ||||| ||||||||||| | |||||||||||  ||  |||||| |||| || ||| |||||  | ||||||| ||||||||    
17362898 tgggagatgcagcagacatgacacgtcatcaagtgtcactgtcatctcccccatcagaagatggaagctaaacatctccttatgccatctctcaacaaaa 17362997  T
138 g 138  Q
    |    
17362998 g 17362998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0391 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0391
Description:

Target: scaffold0391; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 176 - 282
Target Start/End: Original strand, 604 - 711
Alignment:
176 tgtagccactgaagtccaccggctcacatggcatttttgaaccatcactcttgcatcctatccaaatttagttcttgtatag-cagtagcttttttccgt 274  Q
    |||||||| ||||||||||   ||| |||| ||| ||||| ||||  |||||||||||||||||||| | |||||||||||| |||||||||||| ||||    
604 tgtagccattgaagtccacttactcgcatgacatctttgacccattgctcttgcatcctatccaaatgtggttcttgtatagccagtagctttttgccgt 703  T
275 tattcaca 282  Q
    | ||||||    
704 tgttcaca 711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 43 - 138
Target Start/End: Complemental strand, 21118320 - 21118225
Alignment:
43 gatgcagtagacaagacacatcatcaagtgttattgtcatctccctaattggaagattgaagttagacacctcctcgttccatctcccaacaaaag 138  Q
    ||||||| | ||| ||||||||||||||||| ||||| |||||| |||| | || || |||| |||||  |||||||||||||||  |||||||||    
21118320 gatgcagcaaacatgacacatcatcaagtgtcattgttatctccttaatcgaaaaatggaagctagacgtctcctcgttccatctttcaacaaaag 21118225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 44 - 99
Target Start/End: Original strand, 18954443 - 18954498
Alignment:
44 atgcagtagacaagacacatcatcaagtgttattgtcatctccctaattggaagat 99  Q
    |||||||||||| ||||||||||| ||| | ||||||||||||| || ||||||||    
18954443 atgcagtagacatgacacatcatccagtatcattgtcatctccccaactggaagat 18954498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 258
Target Start/End: Complemental strand, 1771956 - 1771900
Alignment:
202 catggcatttttgaaccatcactcttgcatcctatccaaatttagttcttgtatagc 258  Q
    |||||||| |||||| |||| ||||||||||||||||||||||   |||||||||||    
1771956 catggcatctttgaatcatcgctcttgcatcctatccaaatttgactcttgtatagc 1771900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 51 - 269
Target Start/End: Complemental strand, 9031165 - 9030942
Alignment:
51 agacaagacacatcatcaagtgttattgtcatctccctaattggaagattgaagttagacacctcctcgttccatctcccaacaaaagtagataaaaaat 150  Q
    |||||||| ||||||||||||||  |  |||| ||| ||||  |||||| |||| ||||   |||||| | ||||||| ||||||||| |||||| |  |    
9031165 agacaagatacatcatcaagtgtagtcatcatttccttaatcagaagatggaagctagaggactcctcataccatctctcaacaaaagcagataacaggt 9031066  T
151 cgtggtaaaggataggataactgac----tgtagccactgaagtccaccggctcacatggcatttttgaaccatcactcttgcatcctatccaaatttag 246  Q
    ||| || || |||||||||||||||    |||| || |  |||||    ||||| ||||| || | | ||||| | ||||||||||||||||||| || |    
9031065 cgttgtcaaagataggataactgacatgttgtacccgccaaagtctgttggctcgcatggtatctataaaccaccgctcttgcatcctatccaaacttgg 9030966  T
247 ttcttgtata-gcagtagcttttt 269  Q
    ||||||||||  ||||||||||||    
9030965 ttcttgtatatccagtagcttttt 9030942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 197 - 240
Target Start/End: Complemental strand, 42229626 - 42229583
Alignment:
197 gctcacatggcatttttgaaccatcactcttgcatcctatccaa 240  Q
    |||||| ||| || ||||||||||||||||||||||||||||||    
42229626 gctcacgtggtatctttgaaccatcactcttgcatcctatccaa 42229583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 87
Target Start/End: Original strand, 20216363 - 20216397
Alignment:
53 acaagacacatcatcaagtgttattgtcatctccc 87  Q
    ||||||||||||||||||||| |||||||||||||    
20216363 acaagacacatcatcaagtgtcattgtcatctccc 20216397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108206 times since January 2019
Visitors: 1329