View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-23 (Length: 149)

Name: J5-7-23
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-23
J5-7-23
[»] chr2 (2 HSPs)
chr2 (28-141)||(13635411-13635524)
chr2 (28-137)||(27531408-27531514)


Alignment Details
Target: chr2 (Bit Score: 111; Significance: 2e-56; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 28 - 141
Target Start/End: Complemental strand, 13635524 - 13635411
Alignment:
28 gatagcagacaggattttgttgtattcnatattcttagtagttttttatttgatagatagatacgaaagttaaattattttacggaatgcacatgaaagt 127  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13635524 gatagcagacaggattttgttgtattcaatattcttagtagttttttatttgatagatagatacgaaagttaaattattttacggaatgcacatgaaagt 13635425  T
128 gataagcacgtttg 141  Q
    ||||||||||||||    
13635424 gataagcacgtttg 13635411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 28 - 137
Target Start/End: Original strand, 27531408 - 27531514
Alignment:
28 gatagcagacaggattttgttgtattcnatattcttagtagttttttatttgatagatagatacgaaagttaaattattttacggaatgcacatgaaagt 127  Q
    |||| |||||||||| ||||||||||| ||||| |||||   ||||||||||||||| ||||||  ||||||| | |  |||| |||||||| |||||||    
27531408 gataacagacaggatattgttgtattcaatattattagt---tttttatttgatagagagatacataagttaactaaaattactgaatgcacctgaaagt 27531504  T
128 gataagcacg 137  Q
    ||||||||||    
27531505 gataagcacg 27531514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106067 times since January 2019
Visitors: 1319