View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-32 (Length: 354)

Name: J5-7-32
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-32
J5-7-32
[»] chr7 (7 HSPs)
chr7 (27-354)||(22778652-22778979)
chr7 (167-354)||(22775637-22775824)
chr7 (168-335)||(22766121-22766288)
chr7 (167-354)||(16084063-16084250)
chr7 (223-354)||(22783295-22783426)
chr7 (1-33)||(22778975-22779007)
chr7 (168-332)||(23278018-23278182)


Alignment Details
Target: chr7 (Bit Score: 296; Significance: 1e-166; HSPs: 7)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 27 - 354
Target Start/End: Original strand, 22778652 - 22778979
Alignment:
27 attaattaaggtacaataactagacatgacatcgacatgaacatttacaaaccgatcataattnnnnnnnntataatagtgacggaatgcaaaaacacac 126  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||    
22778652 attaattaaggtacaataactagacatgacatcgacatgaacatttacaaaccgatcataattaaaaaaaatataatagtgacggaatgcaaaaacacac 22778751  T
127 acacatgcatacctatatattggtatcagacaaaaatgtgttacctctataacatctccaacattgataactagagcatctgatgttggtttaaccggta 226  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
22778752 acacatgcatacctatatattggtatcagacaaaaatgtgttacctctataacatctccaacattgataactagagcatctgatattggtttaaccggta 22778851  T
227 cccaatttcctttgtttctgatttctaatccaagcacatcatcatcttgaataagtaaggtaatggtggttgtgtcagagtgtggactcaaacccaatac 326  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22778852 cccaatttcctttgtttctgatttctaatccaagcacatcatcatcttgaataagtaaggtaatggtggttgtgtcagagtgtggactcaaacccaatac 22778951  T
327 ttgctcagggttgtcgcaaggagggtaa 354  Q
    |||||||||||||| |||||||||||||    
22778952 ttgctcagggttgttgcaaggagggtaa 22778979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 167 - 354
Target Start/End: Original strand, 22775637 - 22775824
Alignment:
167 ttacctctataacatctccaacattgataactagagcatctgatgttggtttaaccggtacccaatttcctttgtttctgatttctaatccaagcacatc 266  Q
    |||||||||| |||||||| ||||||| |||||||||||||||| ||||  |||| ||||||||||||||||| | ||  |||||||||||| |||||||    
22775637 ttacctctattacatctccgacattgacaactagagcatctgatattggagtaacgggtacccaatttcctttatgtcgaatttctaatccaggcacatc 22775736  T
267 atcatcttgaataagtaaggtaatggtggttgtgtcagagtgtggactcaaacccaatacttgctcagggttgtcgcaaggagggtaa 354  Q
    ||||||||| |||||||| ||||||||| ||| ||| |||||||||||||||||||| |||||||||||  |||||||||||||||||    
22775737 atcatcttgcataagtaaagtaatggtgcttgagtcggagtgtggactcaaacccaacacttgctcaggtgtgtcgcaaggagggtaa 22775824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 168 - 335
Target Start/End: Original strand, 22766121 - 22766288
Alignment:
168 tacctctataacatctccaacattgataactagagcatctgatgttggtttaaccggtacccaatttcctttgtttctgatttctaatccaagcacatca 267  Q
    |||||||||||||||||||||||||| ||| |||||||||||| ||||  |||| || |||||||||||||||||||  |||||||| ||| ||||||||    
22766121 tacctctataacatctccaacattgacaacaagagcatctgatattggaataactggaacccaatttcctttgtttcgaatttctaacccaggcacatca 22766220  T
268 tcatcttgaataagtaaggtaatggtggttgtgtcagagtgtggactcaaacccaatacttgctcagg 335  Q
    |||||||| ||||| | ||||||||||  ||||||||||||||  ||||||||||||||||| |||||    
22766221 tcatcttgcataagaatggtaatggtgcctgtgtcagagtgtgagctcaaacccaatacttgatcagg 22766288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 167 - 354
Target Start/End: Complemental strand, 16084250 - 16084063
Alignment:
167 ttacctctataacatctccaacattgataactagagcatctgatgttggtttaaccggtacccaatttcctttgtttctgatttctaatccaagcacatc 266  Q
    ||||||||||  ||||||||||||||| |||||||||||||| | | ||  | |||||||||||||||||||||| ||  |||||||| ||| | |||||    
16084250 ttacctctattgcatctccaacattgacaactagagcatctgctatgggagttaccggtacccaatttcctttgtgtcgaatttctaacccaggaacatc 16084151  T
267 atcatcttgaataagtaaggtaatggtggttgtgtcagagtgtggactcaaacccaatacttgctcagggttgtcgcaaggagggtaa 354  Q
    ||||||||| | |||||||||||||||||||| |||| ||||||| |||||||| ||||||| ||||||  ||  |||||||||||||    
16084150 atcatcttgcaaaagtaaggtaatggtggttgagtcacagtgtggtctcaaacctaatactttctcaggcatgctgcaaggagggtaa 16084063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 223 - 354
Target Start/End: Original strand, 22783295 - 22783426
Alignment:
223 ggtacccaatttcctttgtttctgatttctaatccaagcacatcatcatcttgaataagtaaggtaatggtggttgtgtcagagtgtggactcaaaccca 322  Q
    ||||||||||||||||||||||  |||||||| |||  ||||||||||||||| || || ||||||||||||  ||||||||| || | ||||| ||| |    
22783295 ggtacccaatttcctttgtttcgaatttctaacccagacacatcatcatcttgcatgagcaaggtaatggtgcctgtgtcagaatgcgaactcataccta 22783394  T
323 atacttgctcagggttgtcgcaaggagggtaa 354  Q
    |||||||||||||  ||| |||||||||||||    
22783395 atacttgctcaggtgtgttgcaaggagggtaa 22783426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 22778975 - 22779007
Alignment:
1 ggtaatagttcacgcgtaaaccttgaattaatt 33  Q
    |||||||||||||||||||||||||||||||||    
22778975 ggtaatagttcacgcgtaaaccttgaattaatt 22779007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 168 - 332
Target Start/End: Complemental strand, 23278182 - 23278018
Alignment:
168 tacctctataacatctccaacattgataactagagcatctgatgttggtttaaccggtacccaatttcctttgtttctgatttctaatccaagcacatca 267  Q
    ||||||||| |||||||||| |||||  |||| ||||| || | |||| ||||  ||||||||||||||||||| ||  | |||||| |||   ||||||    
23278182 tacctctattacatctccaagattgaccactaaagcatttggtattggattaattggtacccaatttcctttgtatcgaacttctaacccagttacatca 23278083  T
268 tcatcttgaataagtaaggtaatggtggttgtgtcagagtgtggactcaaacccaatacttgctc 332  Q
    || ||||| |||| ||  ||||  ||| |||  |||||||||||| |||| || | |||||||||    
23278082 tcgtcttgcataactattgtaactgtgcttgcatcagagtgtggagtcaacccaattacttgctc 23278018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108145 times since January 2019
Visitors: 1329