View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-35 (Length: 243)

Name: J5-7-35
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-35
J5-7-35
[»] chr4 (3 HSPs)
chr4 (49-223)||(40771268-40771442)
chr4 (58-163)||(40777986-40778091)
chr4 (1-54)||(40771458-40771510)
[»] chr5 (1 HSPs)
chr5 (96-161)||(4677086-4677151)


Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 49 - 223
Target Start/End: Original strand, 40771268 - 40771442
Alignment:
49 attaatatctttatagttaangacatgtcacatgataatattagcatcatacctcacttccttggtatttatgtattgagcacgcnaagtctctgatttt 148  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||    
40771268 attaatatctttatagttaaggacatgtcacatgataatattagcatcatacctcacttccttggtatttatgtattgagcacgcaaagtttctgatttt 40771367  T
149 cntcttctgtgtcgtttcatctcgtagtccttacaagatgtatctgagttacaatattaaaacacacatatatca 223  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40771368 cttcttctgtgtcgtttcatctcgtagtccttacaagatgtatctgagttacaatattaaaacacacatatatca 40771442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 58 - 163
Target Start/End: Original strand, 40777986 - 40778091
Alignment:
58 tttatagttaangacatgtcacatgataatattagcatcatacctcacttccttggtatttatgtattgagcacgcnaagtctctgattttcntcttctg 157  Q
    |||| |||||| |||||||||||| || | |||| ||||| ||||||||||||| ||||||||||||||||||||| |||| |||||||||| |||||||    
40777986 tttaaagttaatgacatgtcacataatcagattaacatcagacctcacttccttcgtatttatgtattgagcacgcaaagtttctgattttcctcttctg 40778085  T
158 tgtcgt 163  Q
    ||||||    
40778086 tgtcgt 40778091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 40771458 - 40771510
Alignment:
1 acctcatcacgataacaatcaatcatttaattttacaagaacagttatattaat 54  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||    
40771458 acctcatcacgataacaatcaatcatttaattttac-agaacagttatattaat 40771510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 161
Target Start/End: Complemental strand, 4677151 - 4677086
Alignment:
96 catacctcacttccttggtatttatgtattgagcacgcnaagtctctgattttcntcttctgtgtc 161  Q
    |||||||||||||||| |||||||| || ||||||||| |||| |||||||||| |||||||||||    
4677151 catacctcacttccttagtatttatatactgagcacgcaaagtttctgattttcctcttctgtgtc 4677086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 201205 times since January 2019
Visitors: 1513