View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-7-5 (Length: 273)

Name: J5-7-5
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-7-5
J5-7-5
[»] chr8 (3 HSPs)
chr8 (1-171)||(37389739-37389909)
chr8 (154-273)||(37389624-37389743)
chr8 (62-135)||(44153505-44153579)


Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 37389739 - 37389909
Alignment:
1 tgcgtgagtgcgcgcatgcatataaatgtttaggttgtatgaaatttaacacggtaaattttataaccagtttactacaaacggattacttttttatcta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37389739 tgcgtgagtgcgcgcatgcatataaatgtttaggttgtatgaaatttaacacggtaaattttataaccagtttactacaaacggattacttttttatcta 37389838  T
101 ttcaagtctaagataaagattcatattcttcatacatatctggtggggtgaaaataattaatggcattcaa 171  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||||||    
37389839 ttcaagtctaagataaagattcatattcttcatacatatctagtggggtgaaaataattaattgtattcaa 37389909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 154 - 273
Target Start/End: Original strand, 37389624 - 37389743
Alignment:
154 ataattaatggcattcaatgcatacctagtttaagataaaatttaagataattttagcaaagagcgttatggatccatgctcataaaatacatttttaag 253  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
37389624 ataattaatggcattcaatgcatacctagtttaagataaaatttaagataattttagcaaagagcgttatggatccatgctcataaaatacatttttaaa 37389723  T
254 ccttatatatgtgggtgcgt 273  Q
    ||||||||||||||||||||    
37389724 ccttatatatgtgggtgcgt 37389743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 135
Target Start/End: Complemental strand, 44153579 - 44153505
Alignment:
62 tataaccagtttactacaaacggattacttttttatctattcaag-tctaagataaagattcatattcttcatac 135  Q
    ||||||| | ||||||||| ||||||| ||||||||||| ||||| | |||||||| ||||||||| ||| ||||    
44153579 tataacctgattactacaagcggattaattttttatctaatcaagttttaagataaggattcatatacttgatac 44153505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126585 times since January 2019
Visitors: 1391